View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4406-Insertion-11 (Length: 152)
Name: NF4406-Insertion-11
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4406-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 4e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 4e-55
Query Start/End: Original strand, 36 - 152
Target Start/End: Complemental strand, 16606841 - 16606725
Alignment:
| Q |
36 |
tttattaaagtattgtctgtaaccttcaggttgaagtgcattagcaaataatgtaactttagtgggatcgttaaagcattggtacccttgactttccctc |
135 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16606841 |
tttattaaagtactgtctgtaaccttcaggttgaagtgcattagcaaataatgtaactttagtgggatcgttaaagcattggtacccctgactttccctc |
16606742 |
T |
 |
| Q |
136 |
tcgtttcctttctctgt |
152 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16606741 |
tcgtttcctttctctgt |
16606725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University