View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4406-Insertion-11 (Length: 152)

Name: NF4406-Insertion-11
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4406-Insertion-11
NF4406-Insertion-11
[»] chr4 (1 HSPs)
chr4 (36-152)||(16606725-16606841)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 4e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 4e-55
Query Start/End: Original strand, 36 - 152
Target Start/End: Complemental strand, 16606841 - 16606725
Alignment:
36 tttattaaagtattgtctgtaaccttcaggttgaagtgcattagcaaataatgtaactttagtgggatcgttaaagcattggtacccttgactttccctc 135  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
16606841 tttattaaagtactgtctgtaaccttcaggttgaagtgcattagcaaataatgtaactttagtgggatcgttaaagcattggtacccctgactttccctc 16606742  T
136 tcgtttcctttctctgt 152  Q
    |||||||||||||||||    
16606741 tcgtttcctttctctgt 16606725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University