View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4406_high_8 (Length: 240)
Name: NF4406_high_8
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4406_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 20 - 180
Target Start/End: Original strand, 39032378 - 39032538
Alignment:
| Q |
20 |
cctattacactgttttgctctgtgtgattatatttaaataggggtgcgcatgagccaactcaacctgaagacccgtcccaactcaatagtttcgggtatg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032378 |
cctattacactgttttgctttgtgtgattatattcaaataggggtgcgcatgagccaactcaacatgaagacccgtcccaactcaatagtttcgggtatg |
39032477 |
T |
 |
| Q |
120 |
gtgcatgttccagaaatctaggaaatgggggctgaaaaaattattgaaaggaaagattttg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032478 |
gtgcatgttccagaaatctaggaaatgggggctgaaaaaattattgaaaggaaagattttg |
39032538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 190 - 240
Target Start/End: Original strand, 39032559 - 39032609
Alignment:
| Q |
190 |
atttagatatgaaaatttgcctgaatttgtgtagtcattgcaaaatcgttg |
240 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39032559 |
atttagatatgaatatttgcctgaatttttgtagtcattgcaaaatcgttg |
39032609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University