View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4406_low_11 (Length: 216)
Name: NF4406_low_11
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4406_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 5520273 - 5520076
Alignment:
| Q |
1 |
atatgcatttagtttctgcaaatatataattttctggttttgcgttcttatacgagtctacaactttttacttttgatcttctgtattttattttagtcc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5520273 |
atatgcatttagtctctgcaaatatataattttctggttttgcgttcttatacgagtctacaactttttacttttgatcttctgtattttattttagtcc |
5520174 |
T |
|
| Q |
101 |
ctgcaaaatttgttcatattgaaatctctattaatttgtgtattatttactaaaatgacttgtattatataagaaactgatgaagtattatttctaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5520173 |
ctgcaaaatttgttcatattgaaatctctattaatttgtgtattatttactaaaatgacttgtattatataagaaactgatgaagtattatttctaac |
5520076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 32311863 - 32311804
Alignment:
| Q |
65 |
tttttacttttgatcttctgtattttattttagtccctgcaaaatttgttcatattgaaat |
125 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
32311863 |
tttttacttttgatcct-tgtaatttattttagtctttgcaaaatttattcatattaaaat |
32311804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 129
Target Start/End: Complemental strand, 10140886 - 10140842
Alignment:
| Q |
85 |
tattttattttagtccctgcaaaatttgttcatattgaaatctct |
129 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||| ||||| |
|
|
| T |
10140886 |
tattttattttagttcctacaaaatatgttcatattgaagtctct |
10140842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University