View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4406_low_7 (Length: 309)
Name: NF4406_low_7
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4406_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 13 - 292
Target Start/End: Original strand, 42011624 - 42011903
Alignment:
| Q |
13 |
tgagatcatacaaacccacttctcaaaaatcacaactgaactttgcaagagggattacagtccagagcgcagccacaaaaccagccaagtcaccaggtat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011624 |
tgagatcatacaaacccacttctcaaaaatcacaactgaactttgcaagagggattacagtccagagcgcagccacaaaaccagccaagtcaccaggtat |
42011723 |
T |
 |
| Q |
113 |
cttttctgagttactcttcctgaattaaattgttacagcactttaaagacgtgatagaaacttaacttaacttcactttgtttggaggtaatagctgaag |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011724 |
ctgttctgagttactcttcctgaattaaattgttacagcactttaaagacgtgatagaaacttaacttaacttcactttgtttggaggtaatagctgaag |
42011823 |
T |
 |
| Q |
213 |
aagaatggaaagttaagcgagaattactgctgcaaaaaagggtaaagctctacctctctatcatctgtgccccgcatact |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011824 |
aagaatggaaagttaagcgagaattactgctgcaaaaaagggtaaagctctacctctctatcatctgtgccccgcatact |
42011903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University