View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4407_low_12 (Length: 298)
Name: NF4407_low_12
Description: NF4407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4407_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 38 - 121
Target Start/End: Complemental strand, 5194877 - 5194794
Alignment:
| Q |
38 |
catttactcattgaggtcggcatactatcgcgtcaaagaggaaatggctagacaaagtccataaccatctttggatgagaatgc |
121 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5194877 |
catttactcattgaagtcggcatactatcgcgtcaaagaggaaatggctagacaaagtccataaccacctttggatgagaatgc |
5194794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 38 - 121
Target Start/End: Complemental strand, 5181522 - 5181439
Alignment:
| Q |
38 |
catttactcattgaggtcggcatactatcgcgtcaaagaggaaatggctagacaaagtccataaccatctttggatgagaatgc |
121 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
5181522 |
catttactcattgaagtcggcaacctatcgcgtcaaagaggaaatggctagtcaaagtccataaccacctttggatgagaatgc |
5181439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 38 - 121
Target Start/End: Original strand, 4843294 - 4843377
Alignment:
| Q |
38 |
catttactcattgaggtcggcatactatcgcgtcaaagaggaaatggctagacaaagtccataaccatctttggatgagaatgc |
121 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| ||||| ||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
4843294 |
catttactcattgaagtcggcaaactatcgcgtcaaagagaaaatgactagacaaaatcgataaccatctttggatgaaaatgc |
4843377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 279
Target Start/End: Complemental strand, 5172314 - 5172251
Alignment:
| Q |
216 |
ctatgttaggaaatacaaaagctccggttaatttcaccattgggtttcaacaatagccagtatc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
5172314 |
ctatgttaggaaatacaaaagctccggttcatttcaccattgggtttcaacaatagccaatatc |
5172251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 38 - 119
Target Start/End: Complemental strand, 5159294 - 5159213
Alignment:
| Q |
38 |
catttactcattgaggtcggcatactatcgcgtcaaagaggaaatggctagacaaagtccataaccatctttggatgagaat |
119 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||| ||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
5159294 |
catttactcattgaagttggcaacctatcgcgtcaaagagaaaatgactagacaaaatcgataaccatctttggatgagaat |
5159213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University