View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4407_low_16 (Length: 248)
Name: NF4407_low_16
Description: NF4407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4407_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 46729993 - 46729769
Alignment:
| Q |
8 |
gagcagagacttgaggcctggcgaggaacctgaccgtcaacacagtaacaaatccacaaccaacaactcactacgactatagcaagcatgagtgacctgg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46729993 |
gagcatagacttgaggcctggcgaggaacctgaccatcaacacagtaacaaatccacaaccaacaactcactacgactatagcaagcatgagtggcctgg |
46729894 |
T |
 |
| Q |
108 |
aagcaacttgtaactcctaaaagcaccaccgcatagtcaatgctctttcgagcaaccaggaaaaccattacgagacttaaaacagcccaaatcaatccaa |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46729893 |
aagcaacttgtaactcctaaaagaaccaccacatagtcaatgctctttcgagcaaccaggaaaaccattacgagacttaaaacaacccaaatcaatccaa |
46729794 |
T |
 |
| Q |
208 |
tccaccatagaagcttccaacgaat |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46729793 |
tccaccatagaagcttccaacgaat |
46729769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University