View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4407_low_6 (Length: 332)
Name: NF4407_low_6
Description: NF4407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4407_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 74 - 324
Target Start/End: Original strand, 2961417 - 2961667
Alignment:
| Q |
74 |
caaatcaaatattttaaatgaatttgaatctcatccaaaaagatagtttaaaggatatgagagtgtcaaaacacatgttttgcatcgaacaaccccnnnn |
173 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2961417 |
caaatcaaattttttaaatgaatttgaatctcatccaaaaagatagtttaaaggat--gagagtgtcaaaacacattttttgcatcgaacaaccccaaaa |
2961514 |
T |
 |
| Q |
174 |
nnn-gtctaatgtaagactttgatacaacttgnnnnnnn-tctcatcaaatttgataagcatgacaaatcaaaaattaatccaaactacgcacgatatca |
271 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2961515 |
aaaagtctaatgtaagacttggatacaacttgaaaaaaaatctcatcaaatttgataagcatgaaaaatcaaaaattaatccaaactacgcacggtatca |
2961614 |
T |
 |
| Q |
272 |
attgccttctttattcaattttcaaaatttcaatgcttttcgatcttcatttc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2961615 |
attgccttctttattcaattttcaaaatttcaatgcttttcaatcttcatttc |
2961667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 68 - 114
Target Start/End: Complemental strand, 9792012 - 9791966
Alignment:
| Q |
68 |
aagttacaaatcaaatattttaaatgaatttgaatctcatccaaaaa |
114 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
9792012 |
aagttacaaatcaaatatcttatatgcctttgaatctcatccaaaaa |
9791966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 129
Target Start/End: Original strand, 9784539 - 9784635
Alignment:
| Q |
34 |
ccacccctactatatacttttgatgcttttttgtaagttacaaatcaaatattttaaatgaatttgaatctcatccaa-aaagatagtttaaaggat |
129 |
Q |
| |
|
|||||| | ||||| |||||||||| || |||||||||||||| ||||||||||| ||| ||| ||||| ||| || ||| ||||||||||||| |
|
|
| T |
9784539 |
ccaccctttctataaacttttgatgtcttcttgtaagttacaaaccaaatattttatatgcgtttaaatcttatctaacaaaattagtttaaaggat |
9784635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 87 - 123
Target Start/End: Complemental strand, 23734998 - 23734962
Alignment:
| Q |
87 |
ttaaatgaatttgaatctcatccaaaaagatagttta |
123 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
23734998 |
ttaaatgaatttgaatttcatccaaaaagttagttta |
23734962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University