View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4408-Insertion-8 (Length: 210)

Name: NF4408-Insertion-8
Description: NF4408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4408-Insertion-8
NF4408-Insertion-8
[»] chr1 (1 HSPs)
chr1 (7-210)||(47598035-47598238)
[»] chr3 (2 HSPs)
chr3 (79-111)||(37823155-37823187)
chr3 (7-46)||(37823186-37823225)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 47598035 - 47598238
Alignment:
7 agttatacgaagaatgaatatcttcaattgcagcagtgatactaaactcacattctgaaattggaaccagaaatccctgctttggaacaggctgtgtttg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47598035 agttatacgaagaatgaatatcttcaattgcagcagtgatactaaactcacattctgaaattggaaccagaaatccctgctttggaacaggctgtgtttg 47598134  T
107 tccagtatgcagctggtgtggacggctaatgttcaggaactgccgtatctgagagacnnnnnnngaaacaaataatcagcagaaagcagtgtagtgcact 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||| |||||||||| |||||||||||||||    
47598135 tccagtatgcagctggtgtggacggctaatgttcaggaactgccgtatctgagagacaaaaaaagaaacaaattatcagcagaatgcagtgtagtgcact 47598234  T
207 caag 210  Q
    ||||    
47598235 caag 47598238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 111
Target Start/End: Complemental strand, 37823187 - 37823155
Alignment:
79 atccctgctttggaacaggctgtgtttgtccag 111  Q
    |||||||||||||||||||||||||||||||||    
37823187 atccctgctttggaacaggctgtgtttgtccag 37823155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 46
Target Start/End: Complemental strand, 37823225 - 37823186
Alignment:
7 agttatacgaagaatgaatatcttcaattgcagcagtgat 46  Q
    ||||||||| |||||||||||||||||||||| |||||||    
37823225 agttatacgtagaatgaatatcttcaattgcaacagtgat 37823186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University