View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4408-Insertion-9 (Length: 124)
Name: NF4408-Insertion-9
Description: NF4408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4408-Insertion-9 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 1e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 7 - 124
Target Start/End: Complemental strand, 7554595 - 7554478
Alignment:
| Q |
7 |
acttataaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554595 |
acttataaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaac |
7554496 |
T |
|
| Q |
107 |
ttccgatcttgcctcgtc |
124 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7554495 |
ttccgatcttgcctcgtc |
7554478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 11 - 124
Target Start/End: Complemental strand, 7544813 - 7544700
Alignment:
| Q |
11 |
ataaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaacttcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7544813 |
ataaactttccccgacgccgtaatggccggacaagttcccagaaactcttttcaccaccgtcctccgcggtaaacttcggcaccgtcatcgccaacttcc |
7544714 |
T |
|
| Q |
111 |
gatcttgcctcgtc |
124 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7544713 |
gatcttgcctcgtc |
7544700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University