View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4408_low_7 (Length: 321)
Name: NF4408_low_7
Description: NF4408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4408_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 91 - 305
Target Start/End: Original strand, 49015689 - 49015903
Alignment:
| Q |
91 |
attaacagaggagcttcaagaagcaactctcagtgttaatgggaagtgcattgttgcaaagttgctaactacaacacttgtgggaactggttatggattg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49015689 |
attaacagaggagcttcaagaagcaactctcagtgttaatgggaagtgcattgttgcaaagttgctaactacaacacttgtgggaactggttatggattg |
49015788 |
T |
 |
| Q |
191 |
tctaacaatggtatttttatttgtttttatgatcacatgagatacttgttatctttatcaatatggaaagtaaattttgattttgaaataagaaagttat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49015789 |
tctaacaatggtatttttatttgtttttatgatcacatgagatacttgttatctttatcaatacggaaagtaaattttgattttgaaataagaaagttat |
49015888 |
T |
 |
| Q |
291 |
tacaattttaaatat |
305 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49015889 |
tacaattttaaatat |
49015903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 49015609 - 49015652
Alignment:
| Q |
16 |
atcgtagagtatagtagaaactaaaattgatctgtttaacatag |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49015609 |
atcgtagagtatagtagaaactaaaattgatctgtttaacatag |
49015652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University