View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_high_10 (Length: 355)
Name: NF4410_high_10
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 7 - 162
Target Start/End: Original strand, 28306567 - 28306722
Alignment:
| Q |
7 |
ctatgggtggtcaatttgtcatggattgagtggcctcatgtccattactcattggcaatatccagtgacaggcacatgtctttgcttatgtctattggtt |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28306567 |
ctatgggtggtcaatttatcatggattgagtggcctcatgtccattactcattggcaatatccagtgacaggcacatgtctttgcttatgtctattggtt |
28306666 |
T |
 |
| Q |
107 |
ggctggtaaagggaatggtctttttcaagttttcaattaagagttcattgatcctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28306667 |
ggctggtaaagggaatggtctttttcaagttttcaattaagagttcattgatcctt |
28306722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 170 - 234
Target Start/End: Original strand, 28306755 - 28306819
Alignment:
| Q |
170 |
taaatttaaatatgcaaatgatacatgcaaaaatcaagtgtctaagttttagatctataaaaata |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28306755 |
taaatttaaatatgcaaatgatacatgcaaaaatcaagtgtctaagttttagatctataaaaata |
28306819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 28306885 - 28306924
Alignment:
| Q |
300 |
aaaatctatttatattcaaatgtgtctctctaacattcat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28306885 |
aaaatctatttatattcaaatgtgtctctctaacattcat |
28306924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University