View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_37 (Length: 233)
Name: NF4410_low_37
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 89 - 217
Target Start/End: Original strand, 47078584 - 47078712
Alignment:
| Q |
89 |
taggtaggtagataaataagaaacatcgtagggaaaaaggtggcaaccgtttcagattattaaataacagatgcattcttatgtataggaatattacctt |
188 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47078584 |
taggtagataaataaataagaaacatcgcagggaaaaaggtggcaaccgtttcagattattaaataacagatgcattcttatgtataggaatattacctt |
47078683 |
T |
 |
| Q |
189 |
tgatgcaatgtccagatcaagcaagttac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47078684 |
tgatgcaatgtccagatcaagcaagttac |
47078712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 96
Target Start/End: Original strand, 47077105 - 47077133
Alignment:
| Q |
68 |
cattggatgtagtagtggttctaggtagg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47077105 |
cattggatgtagtagtggttctaggtagg |
47077133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 218
Target Start/End: Complemental strand, 18229077 - 18229019
Alignment:
| Q |
159 |
atgcattcttatgtataggaatattacctttgatgcaatgtccagatcaagcaagttact |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
18229077 |
atgcattcttatgtataggaa-attacctttgatacaatgtcaagatcaagtaagttact |
18229019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University