View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_high_26 (Length: 251)
Name: NF4411_high_26
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 81 - 239
Target Start/End: Original strand, 4172805 - 4172963
Alignment:
| Q |
81 |
aaatgattttcatttttcatgaaacatgttcgtactacctgaaaaacatgtcttaagtacgtgatttttcatatctaacactgttatcattgagaagttt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172805 |
aaatgattttcatttttcatgaaacatgttcgtactacctgaaaaacatgtcttaagtacgtgaattttcatatctaacactgttatcattgagaagttt |
4172904 |
T |
|
| Q |
181 |
gttcgtttgttctatggatcttatgaaggggcaatcaagactacatgatgacaaagttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4172905 |
gttcgtttgttctatggatcttatgaaggggcaatcaagactacatgatgataaagttg |
4172963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 4172776 - 4172808
Alignment:
| Q |
12 |
atgaaacataatttgagagcaattctaataaat |
44 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
4172776 |
atgaaacataatttgagaccaattctaataaat |
4172808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 63
Target Start/End: Original strand, 30398286 - 30398318
Alignment:
| Q |
31 |
caattctaataaatttgaattgcaaaatagaga |
63 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
30398286 |
caattctaataaatttggattgcaaaatagaga |
30398318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University