View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_high_29 (Length: 242)
Name: NF4411_high_29
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_high_29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 33886998 - 33887228
Alignment:
| Q |
18 |
tctctaacaatatcaaagttgtacctacaaacaacgcagcaaagttgttagttagttagggtttgattctgccactgcacag------ggacagggaata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33886998 |
tctctaacaatatcaaagttgtacctacaaacaacgcagtaaagttgttggttagttagggtttgattctgccactgcacagggacagggacagggaata |
33887097 |
T |
|
| Q |
112 |
gatcactgctcacattccgtatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatattcttacttctcagc |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33887098 |
gatcactgctcacattccttatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatatacttacttctcagc |
33887197 |
T |
|
| Q |
212 |
aaatctcttccgctcttccctctcaaaattt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33887198 |
aaatctcttccgctcttccctctcaaaattt |
33887228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University