View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_low_23 (Length: 348)
Name: NF4411_low_23
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 11 - 331
Target Start/End: Complemental strand, 12941405 - 12941085
Alignment:
| Q |
11 |
ggagcagagaaaccaaacaaaacaagaggaacctattttttagcataaaatttctctccaatgggtctttattatttgagcacaaaactcatttttgaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12941405 |
ggagcagagaaaccaaacaaaacaagagcaacctattttttagcataaaatttctctccaatgagtctttattatttgagcacaaaactcatttttgaga |
12941306 |
T |
 |
| Q |
111 |
atatgtttaggatttttacattattgctctctttcaaatttagcatatcatataaaattcaagcttcatttgtttttggtgattctttgctcgatgtagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12941305 |
atatgtttaggatttttacattattgctctctttcaaatttagcatatcatataaaattcaagcttcatttgtttttggtgattctttgctcgatgtagg |
12941206 |
T |
 |
| Q |
211 |
gaacaacaattacatcacttcacttgccaaagcaaatcatcacccttatggaattgattttggaaaacccacaggtcgtttttgtaatggaagaaccgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12941205 |
gaacaacaattacatcacttcacttgccaaagcaaatcatcacccttatggaattgattttggaaaacccacaggtcgtttttgtaatggaagaaccgtt |
12941106 |
T |
 |
| Q |
311 |
gttgatgttataggtaagagt |
331 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12941105 |
gttgatgttataggtaagagt |
12941085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University