View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4411_low_24 (Length: 338)

Name: NF4411_low_24
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4411_low_24
NF4411_low_24
[»] chr7 (1 HSPs)
chr7 (18-324)||(32016940-32017246)
[»] chr5 (1 HSPs)
chr5 (114-157)||(919392-919435)
[»] chr6 (1 HSPs)
chr6 (117-167)||(26397728-26397778)
[»] chr8 (1 HSPs)
chr8 (117-157)||(27185603-27185643)
[»] chr2 (1 HSPs)
chr2 (124-168)||(8453176-8453220)


Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 324
Target Start/End: Original strand, 32016940 - 32017246
Alignment:
18 aagtagatgctgaaagggttttggttagtttggcacgcaattatttgggtgatatggaaagctagaaatgcaaagatatttgagaatcattcaaaagatg 117  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32016940 aagtagatgcggaaagggttttggttagtttggcacgcaattatttgggtgatatggaaagctagaaatgcaaagatatttgagaatcattcaaaagatg 32017039  T
118 tggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttactagtggaattgggatcc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
32017040 tggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttacgagtggaattgggatcc 32017139  T
218 tgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggtgttttcc 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
32017140 tgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggttttttcc 32017239  T
318 cctatgc 324  Q
    |||||||    
32017240 cctatgc 32017246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 114 - 157
Target Start/End: Original strand, 919392 - 919435
Alignment:
114 gatgtggaggagatggtggaagagatcaaggtgttgtcttggag 157  Q
    |||||||| ||||| ||||| |||||||||||||||||||||||    
919392 gatgtggaagagatagtggaggagatcaaggtgttgtcttggag 919435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 167
Target Start/End: Original strand, 26397728 - 26397778
Alignment:
117 gtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttg 167  Q
    ||||| ||||| |||||||||||||||||  |||||||| |||||||||||    
26397728 gtggatgagatagtggaagagatcaaggtaatgtcttggcgatggatgttg 26397778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 27185643 - 27185603
Alignment:
117 gtggaggagatggtggaagagatcaaggtgttgtcttggag 157  Q
    ||||| ||||| |||||||||||||||| ||||||||||||    
27185643 gtggatgagatagtggaagagatcaaggggttgtcttggag 27185603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 8453176 - 8453220
Alignment:
124 agatggtggaagagatcaaggtgttgtcttggagatggatgttga 168  Q
    |||| ||||| ||| | ||||||||||||||||||||||||||||    
8453176 agattgtggaggaggtgaaggtgttgtcttggagatggatgttga 8453220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University