View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_low_25 (Length: 332)
Name: NF4411_low_25
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 172 - 267
Target Start/End: Original strand, 33887347 - 33887442
Alignment:
| Q |
172 |
tacctgaacgattttaaattgtggttggttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaatattag |
267 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887347 |
tacctgaacgattttaaattgtggttcgttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaatattag |
33887442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 33887195 - 33887260
Alignment:
| Q |
1 |
agcaaatctcttccgctcttcccactcaaaatttgcaaagaattcatcaatctcctcttccctgaa |
66 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33887195 |
agcaaatctcttccgctcttccctctcaaaatttgcaaagaattcatcaatctccgcctccctgaa |
33887260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University