View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4411_low_32 (Length: 251)

Name: NF4411_low_32
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4411_low_32
NF4411_low_32
[»] chr8 (2 HSPs)
chr8 (81-239)||(4172805-4172963)
chr8 (12-44)||(4172776-4172808)
[»] chr7 (1 HSPs)
chr7 (31-63)||(30398286-30398318)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 81 - 239
Target Start/End: Original strand, 4172805 - 4172963
Alignment:
81 aaatgattttcatttttcatgaaacatgttcgtactacctgaaaaacatgtcttaagtacgtgatttttcatatctaacactgttatcattgagaagttt 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
4172805 aaatgattttcatttttcatgaaacatgttcgtactacctgaaaaacatgtcttaagtacgtgaattttcatatctaacactgttatcattgagaagttt 4172904  T
181 gttcgtttgttctatggatcttatgaaggggcaatcaagactacatgatgacaaagttg 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
4172905 gttcgtttgttctatggatcttatgaaggggcaatcaagactacatgatgataaagttg 4172963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 4172776 - 4172808
Alignment:
12 atgaaacataatttgagagcaattctaataaat 44  Q
    |||||||||||||||||| ||||||||||||||    
4172776 atgaaacataatttgagaccaattctaataaat 4172808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 63
Target Start/End: Original strand, 30398286 - 30398318
Alignment:
31 caattctaataaatttgaattgcaaaatagaga 63  Q
    ||||||||||||||||| |||||||||||||||    
30398286 caattctaataaatttggattgcaaaatagaga 30398318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University