View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_low_41 (Length: 232)
Name: NF4411_low_41
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 7965658 - 7965855
Alignment:
| Q |
20 |
tattgctggtaggtgtggtttcatagggttttaatccattgcatttagaaattcnnnnnnncatataaagtaggttcagcttttgaccagaacaactgca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7965658 |
tattgctggtaggtgtggtttcatagggttttaatccattgcatttagaaattcaaaaaaacatataaagtaggttcagcttttgaccagaacaactgca |
7965757 |
T |
 |
| Q |
120 |
gttgtagtgtgtactgatgaacttttgtcaattattttcctagttacttaccattgcttagttttgaagggaaactttgcagttccttattacccttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7965758 |
gttgtagtgtgtactgatgaacttttctcaattattttcctagttacttaccattgcttagttttgaagggaaactttgcagttccttattacccttt |
7965855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University