View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4411_low_42 (Length: 230)
Name: NF4411_low_42
Description: NF4411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4411_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 39 - 218
Target Start/End: Complemental strand, 32269534 - 32269355
Alignment:
| Q |
39 |
gatcatatatttaattagtctaagtttcttaccacttggatcaatcattgttggtaagcaatgcaacctttaactttcttaattttatgcattcaatgtt |
138 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32269534 |
gatcatatatttaattagtctaaatttcttaccacttggaccaatcattgttggtaagcaatgcaatctttaactttcttaattttatgcattcaatgtt |
32269435 |
T |
 |
| Q |
139 |
attttgtttggtggtgacattcaatgttatttaaacaaaacccataaatttcacttatatattccacttctttcatctca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32269434 |
attttgtttggtggtgacattcaatgttatttaaacaaaacccataaatttcacttatatattccacttctttcatctca |
32269355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 218
Target Start/End: Complemental strand, 32809524 - 32809420
Alignment:
| Q |
114 |
ttcttaattttatgcattcaatgttattttgtttggtggtgacattcaatgttatttaaacaaaacccataaatttcacttatatattccacttctttca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| || |
|
|
| T |
32809524 |
ttcttaattttatgcattcaatgttattttgtttggtggtgacattcaatgttatttaaacacaacccacccacttcacttatttattccacttcttaca |
32809425 |
T |
 |
| Q |
214 |
tctca |
218 |
Q |
| |
|
||||| |
|
|
| T |
32809424 |
tctca |
32809420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University