View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412-Insertion-5 (Length: 377)
Name: NF4412-Insertion-5
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 8 - 370
Target Start/End: Complemental strand, 14811706 - 14811344
Alignment:
| Q |
8 |
ttttctctcttgattctattgtgtttattttgttcgtagggcaacaagattcaggcaacaatcccatcctagtgtgttggccgcttaggacctttgttct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811706 |
ttttctctcttgattctattgtgtttattttgttcgtagggcaacaagattcaggcaacaatcccatcctagtgtgttggccgcttaggacctttgttct |
14811607 |
T |
|
| Q |
108 |
tcgggcatttagtgtatgttattaccactttcaatgttgttgatagtgttaatggctcctttgccactggtaacaaaaagaggattatgcttaggttggg |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
14811606 |
tcgggcatttagtgtatgttatcaccactttcaatgttgttgatagtgttaatggctcctttgccactggtaacagaaagagcattatgcttaggttggg |
14811507 |
T |
|
| Q |
208 |
tacaagggttgtaatggatgatagctttctcattcataagtatgggttgactttgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcga |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811506 |
tacaagggttgtaatggatgatagctttctcattcataagtatgggttgacttcgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcgg |
14811407 |
T |
|
| Q |
308 |
ttggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgttcattcacattt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
14811406 |
ttggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgtttatttacattt |
14811344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University