View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412-Insertion-8 (Length: 138)
Name: NF4412-Insertion-8
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 36878405 - 36878535
Alignment:
| Q |
8 |
gaaaggtgctaccagtggtagacccaatggaagacccttcactcgtttagatgcaattaaacaagccattgttcttttcgtcaatgctaaactcaccatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878405 |
gaaaggtgctaccagtggtagacccaatggaagacccttcactcgtttagatgcaattaaacaagccattgttcttttcgtcaatgctaaactcaccatc |
36878504 |
T |
 |
| Q |
108 |
aatcctcaacatcgttttgctttcgctactc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36878505 |
aatcctcaacatcgttttgctttcgctactc |
36878535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University