View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_high_11 (Length: 247)
Name: NF4412_high_11
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_high_11 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 81 - 247
Target Start/End: Complemental strand, 53676596 - 53676430
Alignment:
| Q |
81 |
taaggttagccgaatagaagcaattaggacacgatctttataggtcatgatcatggctaataggatttaggctcaaacacatttgtctgtaaatatcact |
180 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676596 |
taaggttagccgaataatagcaattaggacacgatctttatatgtcatgatcatggctaataggatttaggctcaaacacatttgtctgtaaatatcact |
53676497 |
T |
 |
| Q |
181 |
tgtaatttgtaaactttatatcagagagactcaatgaatcaaataacttagttttaaaatattgttt |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676496 |
tgtaatttgtaaactatatatcagagagactcaatgaatcaaataacttagttttaaaatattgttt |
53676430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 53676676 - 53676622
Alignment:
| Q |
26 |
gcttgaaatgagtaatagaacaagacacataaagaccaacactataaaaaataac |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
53676676 |
gcttgaaatgagtaatagaacaagacacataaagaccaatactatacaaaataac |
53676622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University