View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_high_17 (Length: 216)
Name: NF4412_high_17
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 45559909 - 45559709
Alignment:
| Q |
1 |
agtagaaaggctgagataggtgagtttgtggaggttagagaatgagtgaggtatttggccggtaaagtaattagaagaaaggtctaaatagttgaggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45559909 |
agtagaaaggctgagataggtgagtttgtggaggttagagaatgagtgaggtatttgaccggtaaagtaattagaagaaaggtctaagtagttgaggtgt |
45559810 |
T |
 |
| Q |
101 |
gtgcaattagaaatttcaggtcgtaatggagcatgaatgttaaaagaggaaaggttgagagagactacacggtgagtggaagggttgcatttgacaccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45559809 |
gtgcaattagaaatttcaggtcgtaatggagcatgaatgttacaagaggaaaggttgagagagactacacggtgagtggaagggttgcatttgacaccct |
45559710 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
45559709 |
t |
45559709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University