View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_high_3 (Length: 467)
Name: NF4412_high_3
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 11 - 449
Target Start/End: Original strand, 52630608 - 52631049
Alignment:
| Q |
11 |
cacagacaaatacaagtaatcagtccaagacataggtgctaacccatactccaatgttgacttcagaacatgtatccataattcaccaccccaaacatcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630608 |
cacagacaaatacaagtaatcagtccaagacataggtgctaacccatactccaatgttgccttcagaacatgtatccataattcaccaccccaaacatcc |
52630707 |
T |
 |
| Q |
111 |
acatacatttctttctcccaaattagaggacccttaattcctacacctccttttcccatttcaatcaccactcctttcatccctgtatctgcttgtccgt |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
52630708 |
acatacatttctttctcccaaactagaggacccttaattcctacacctccttttcccatttcaatcaccactcctttcatccttgtatccgcttgtccgt |
52630807 |
T |
 |
| Q |
211 |
ttattgagtgtccgtgtcctctcgctgacaccgcaa---acttctgccatttatacgccgctttaactacccttgccacgtcattggccgacgctggtcg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630808 |
ttattgagtgtccgtgtcctctcgctgacaccgcaaagtactgctgccatttatacgccgctttaactacccttgccacgtcattggccgacgctggtcg |
52630907 |
T |
 |
| Q |
308 |
aaccaccgcaatcgtctctcctttgctgcttaacctcccaaaatccaatgaagctgcttctaattcagcggcctccgtgcttacttcaccttcaagtcct |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52630908 |
aaccaccgcaatcgtctctcctttgctgcttaacctcccaaaatccaatgaagctgcttctaatttagcggcctccgtgcttacttcaccttcaagtcct |
52631007 |
T |
 |
| Q |
408 |
atgtggaggatctccgttaatgtttgatccactgttaatcct |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52631008 |
atgtggaggatctccgttaatgtttgatccactgttaatcct |
52631049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 12 - 40
Target Start/End: Complemental strand, 17243465 - 17243437
Alignment:
| Q |
12 |
acagacaaatacaagtaatcagtccaaga |
40 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17243465 |
acagacaaatacaagtaatcagtccaaga |
17243437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University