View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_low_25 (Length: 228)
Name: NF4412_low_25
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 55 - 205
Target Start/End: Original strand, 35879184 - 35879334
Alignment:
| Q |
55 |
cattgtcaaaggtgagactctaacacacaaaaaatgcggagaaaaagagtattgaaaattcaatctcggccttgatacatcaaatatttttgcagtaatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35879184 |
cattgtcaaaggtgagactctaacacacaaaaaatgcggagaaaaagagtattgaaaattcaatctcggccttgacacatcaaatatttttgcagtaatt |
35879283 |
T |
|
| Q |
155 |
ttatcatttgacttgcaggcttatatttatatatttgttaacaaaaagaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35879284 |
ttatcatttgacttgcaggcttatatttatatatttgttaactaaaagaat |
35879334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 55 - 205
Target Start/End: Original strand, 24453385 - 24453535
Alignment:
| Q |
55 |
cattgtcaaaggtgagactctaacacacaaaaaatgcggagaaaaagagtattgaaaattcaatctcggccttgatacatcaaatatttttgcagtaatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24453385 |
cattgtcaaaggtgagactctaacacacaaaaaatgcggagaaaaagagtattgaaaattcaatctcggccttgacacatcaaatatttttgcagtaatt |
24453484 |
T |
|
| Q |
155 |
ttatcatttgacttgcaggcttatatttatatatttgttaacaaaaagaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24453485 |
ttatcatttgacttgcaggcttatatttatatatttgttaactaaaagaat |
24453535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University