View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_low_26 (Length: 228)
Name: NF4412_low_26
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 1285371 - 1285180
Alignment:
| Q |
18 |
aatacaatatcaagagggtaacttgtnnnnnnnnnttttgggcaggtaacttgtaaacattttacaagatatataaggacttaccaagaaaataaataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1285371 |
aatacaatatcaagagggtaacttgtaaacaatttttttgggcaggtaacttgtaaacattttacaagatatataaggacttaccaagaaaataaataaa |
1285272 |
T |
|
| Q |
118 |
ttaataaagtgtataaacaagataaatgacaccgaatgggtctttgcctataacttaatgggaaatgatatttgtacgatccatttgcgatatt |
211 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1285271 |
ttaataaagtgtataaacatgataaat--aaattaatgggtctttgcctataacttaatgggaaatgatatttgtacgattaatttgcgatatt |
1285180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University