View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4412_low_9 (Length: 347)
Name: NF4412_low_9
Description: NF4412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4412_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 262
Target Start/End: Original strand, 46485013 - 46485262
Alignment:
| Q |
13 |
aatattgcaacttttgatggagatgtgctttcaagattttgttcatgtcgctgtgaacaaaaaacggtttcgttgttcatgagtgcttaatcaatcgttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46485013 |
aatattgcaacttttgatggagatgtgctttcaagattttgttcatgtcgctgtgaacaaaaaaaggtttcgttgttcatgagtgcttaatcaatcgttt |
46485112 |
T |
|
| Q |
113 |
ctatttaaggtgttagaatgtgagatataactaataatactgagaaagtacatgctcatgtttcctttaaattaaaattcaatgtatgctgtatgcctaa |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46485113 |
ctatttaaggtgtgagaatgtgagatataactaataatactgagaaagtac-tgctcatgtttcctttaaattaaaattcaatgtatgctgtatgcctaa |
46485211 |
T |
|
| Q |
213 |
ctttcattgtcacattatttgtttctaaattg-tttagtcgaaaatgtaac |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46485212 |
ctttcattgtcacattatttgtttctaaattgttttagtcgaaaatgtaac |
46485262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University