View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4413-Insertion-11 (Length: 75)
Name: NF4413-Insertion-11
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4413-Insertion-11 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 4e-31; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 44928476 - 44928409
Alignment:
| Q |
8 |
ccttgaacctccttctccatacaaattattccattgctccagcattttcatatttgatccttctgtag |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44928476 |
ccttgaacctccttctccatacaaattattccattgctccagcattttcatatttgatccttctgtag |
44928409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 44937410 - 44937376
Alignment:
| Q |
8 |
ccttgaacctccttctccatacaaattattccatt |
42 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
44937410 |
ccttgaacctccttctccatacaaatcattccatt |
44937376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 45990578 - 45990546
Alignment:
| Q |
8 |
ccttgaacctccttctccatacaaattattcca |
40 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
45990578 |
ccttgaacctccttctccatacaaatcattcca |
45990546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University