View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4413-Insertion-3 (Length: 383)
Name: NF4413-Insertion-3
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4413-Insertion-3 |
 | |
|
| [»] scaffold0047 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 234 - 290
Target Start/End: Original strand, 13786530 - 13786586
Alignment:
| Q |
234 |
gagagggaaaagtgttcaaagtttagctctgagtttataagttcgtatgaagtgatt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||| | || |||||||| |
|
|
| T |
13786530 |
gagagggaaaagtgttcaaagtttagctttgagtttatgagtttgcataaagtgatt |
13786586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 288
Target Start/End: Complemental strand, 10717 - 10650
Alignment:
| Q |
223 |
agtatttgctc--gagagggaaaagtgttcaaagtttagctctgagtttataagttcgtatgaagtga |
288 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| ||||||||| |||||| || |||||| |
|
|
| T |
10717 |
agtatttgctcaagagagtgaaaagtgttcaaagtttagtgttgagtttatgagttcgcataaagtga |
10650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University