View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4413-Insertion-4 (Length: 374)
Name: NF4413-Insertion-4
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4413-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 8 - 304
Target Start/End: Complemental strand, 45596437 - 45596141
Alignment:
| Q |
8 |
attgcagccctttggaataatttcaaagtatgtaatctctttgtatataaatttctatcttattgttgatttatcatttattgaccttaatatctaagtt |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596437 |
attgcagccctttgggataatttcaaagtatgtaatctctttgtatataaatttctatcttattgttgatttatcatttattgaccttaatatctaagtt |
45596338 |
T |
|
| Q |
108 |
ctctaacatactctacaattttcttacgattgactaaaggttattcaagcttccaaatcagattctcgactagcaaataaccatctacctcaagatattc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596337 |
ctctaacatactctacaattttcttacgattgactaaaggttattcaagcttccaaatcagattctcgactagcaaataaccatctacctcaagatattc |
45596238 |
T |
|
| Q |
208 |
aaaagcttcgctgccgtgcttgttatgaagctcttcgtttttctcctcacattgaacagatggggaaggtatatcagtagatacaaactcttgttgg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596237 |
aaaagcttcgctgccgtgcttgttatgaagctcttcgtttttctcctcgcattgaacagatggggaaggtatatcagtagatacaaactcttgttgg |
45596141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 145 - 281
Target Start/End: Complemental strand, 27152022 - 27151886
Alignment:
| Q |
145 |
aggttattcaagcttccaaatcagattctcgactagcaaataaccatctacctcaagatattcaaaagcttcgctgccgtgcttgttatgaagctcttcg |
244 |
Q |
| |
|
||||||||| ||||| ||||| ||||| || ||||| || ||| ||||||||| ||| |||||||||||||| ||||| ||||| |||||||| || || |
|
|
| T |
27152022 |
aggttattcgtgcttcaaaatccgattcacggctagcgaacaacaatctacctccagacattcaaaagcttcgttgccgagcttgctatgaagcactccg |
27151923 |
T |
|
| Q |
245 |
tttttctcctcacattgaacagatggggaaggtatat |
281 |
Q |
| |
|
||| ||||||| |||||||| || || ||||||||| |
|
|
| T |
27151922 |
tttctctcctcgtattgaacaaataggaaaggtatat |
27151886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University