View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4413-Insertion-7 (Length: 325)
Name: NF4413-Insertion-7
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4413-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 128 - 325
Target Start/End: Complemental strand, 2442701 - 2442505
Alignment:
| Q |
128 |
gaaaggacacttaaaccaacttaacttattgcgttactattgatgaacatataaggctaggacaaacttaaactaacttaatgatactactaactcttac |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442701 |
gaaaggacacttaaaccaacttaacttattgtgttactattgatgaacatataaggctaggacaaacttaaactaacttaatgatactactaactcttac |
2442602 |
T |
|
| Q |
228 |
acaagcgagtaagagttcagtttagtttaatttttgggagaaaataaatccgaaacaataaaaaataattgcttttgtctggtccgaattttacaata |
325 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2442601 |
acaagc-agtaagagttcagtttagtttaatttttgggagaaaataaatccgaaacaataaaaaataattgcttttgtctggtccggattttacaata |
2442505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University