View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4413-Insertion-8 (Length: 302)
Name: NF4413-Insertion-8
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4413-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 8e-58; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 115 - 242
Target Start/End: Complemental strand, 3256482 - 3256358
Alignment:
| Q |
115 |
ctaagttggacaattcagagaaaacaagagggtagggtttttgccttgccgatgaagaaaagaagggaaaaagagaggcttctttcgacttcttctacag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256482 |
ctaagttggacaattcagagaaaacaaga---tagggtttttgccttgccgatgaagaaaagaagggaaaaagagaggcttctttcgacttcttctacag |
3256386 |
T |
|
| Q |
215 |
ctgaggttaatttctgcatgtgttacac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3256385 |
ctgaggttaatttctgcatgtgttacac |
3256358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 64
Target Start/End: Complemental strand, 3256778 - 3256727
Alignment:
| Q |
13 |
aagtagtagtagagcataaagtgattaatcaaactttttcacttcacgtaat |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3256778 |
aagtagtagtagagcataaagtgattaatcaaagtttttcacttcacgtaat |
3256727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 56 - 114
Target Start/End: Original strand, 9964044 - 9964102
Alignment:
| Q |
56 |
tcacgtaattttatctaaactgcgtcgtttatgctatcagtagagcagcggttggtaaa |
114 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
9964044 |
tcacataattttatctaaactacgtcgtttatactatcagtaaagcagcggttggtaaa |
9964102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 89
Target Start/End: Complemental strand, 3256519 - 3256486
Alignment:
| Q |
56 |
tcacgtaattttatctaaactgcgtcgtttatgc |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
3256519 |
tcacataattttatctaaactgcgtcgtttatgc |
3256486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University