View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4413_high_6 (Length: 303)

Name: NF4413_high_6
Description: NF4413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4413_high_6
NF4413_high_6
[»] chr4 (5 HSPs)
chr4 (1-293)||(5920973-5921263)
chr4 (1-166)||(5934558-5934723)
chr4 (1-138)||(5532770-5532907)
chr4 (1-132)||(38176916-38177047)
chr4 (210-290)||(5934412-5934494)
[»] chr8 (2 HSPs)
chr8 (5-106)||(40916226-40916327)
chr8 (2-93)||(45320547-45320638)
[»] chr2 (1 HSPs)
chr2 (1-78)||(11731826-11731903)
[»] chr1 (1 HSPs)
chr1 (1-144)||(45452322-45452465)
[»] chr7 (1 HSPs)
chr7 (1-111)||(34841839-34841949)
[»] chr3 (1 HSPs)
chr3 (5-69)||(53145991-53146055)


Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 5921263 - 5920973
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  5921263 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtctgaatatcaacagtatcaa 5921164  T
Q  101 gatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgagatgtgagcatgttgatgctttttgcaatggataa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5921163 gatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgagatgtgagcatgttgatgctttttgcaatggataa 5921064  T
Q  201 cacatatctgcaacttcctgttgccggttcgtaatctctgttgtaaggggatacttttgttccggctgttatgaaattgtttctggttttcat 293  Q
    |||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  5921063 cac--atctgcaacttcctgttgccggttcgtaatctctgttgtaagggaatacttttgttccggctgttatgaaattgtttctggttttcat 5920973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 5934723 - 5934558
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  5934723 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcagaatatcaacagtatcaa 5934624  T
Q  101 gatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgag 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5934623 gatgctactgcagaggaggatgagtatgaagatgaagaggaggattatcagcaggaacatgatgag 5934558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 5532770 - 5532907
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    |||||||||||||||||| |||||||| ||||| || ||||| |||||||||||||||||||||||||||||||| ||  | || ||||||||||| |||    
T  5532770 tttcttgcattggtacactggtgaaggcatggacgaaatggaattcactgaggctgagagcaacatgaatgatctggttgctgagtatcaacagtaccaa 5532869  T
Q  101 gatgctactgcagaggaggatgagtatgaagatgaaga 138  Q
    ||||| || || || ||||||||||||| ||| |||||    
T  5532870 gatgccaccgctgatgaggatgagtatggagaagaaga 5532907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 38177047 - 38176916
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    |||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||| | ||| | || || || || || ||     
T  38177047 tttcttgcattggtacactggtgagggaatggatgaaatggagttcactgaggccgagagtaacatgaatgatttggtggcagagtaccagcaataccag 38176948  T
Q  101 gatgctactgcagaggaggatgagtatgaaga 132  Q
    ||||||||||| || ||||| |||||||||||    
T  38176947 gatgctactgctgatgaggaagagtatgaaga 38176916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 210 - 290
Target Start/End: Complemental strand, 5934494 - 5934412
Alignment:
Q  210 gcaacttcctgttgccggttcgtaatctc--tgttgtaaggggatacttttgttccggctgttatgaaattgtttctggtttt 290  Q
    ||||||||||||||||||||| |||||||  ||||||  |||||| ||| ||||| ||||||| |||||||| ||||| ||||    
T  5934494 gcaacttcctgttgccggttcataatctctttgttgttgggggatgcttatgttctggctgttctgaaattgattctgatttt 5934412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 106
Target Start/End: Complemental strand, 40916327 - 40916226
Alignment:
Q  5 ttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaagatg 104  Q
    ||||||||||| || | |||||||||||||||||||||||| |||||||||||||| || ||||||||| | || || ||||||||||| ||||||||||    
T  40916327 ttgcattggtatactgctgaaggaatggatgagatggagtttactgaggctgagagtaatatgaatgatttggtttctgaatatcaacaatatcaagatg 40916228  T
Q  105 ct 106  Q
    ||    
T  40916227 ct 40916226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 93
Target Start/End: Original strand, 45320547 - 45320638
Alignment:
Q  2 ttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaaca 93  Q
    |||||||||||||| || || |||||||||||||| ||||| || ||||| || || ||||| ||||||||||||||  | |||||||||||    
T  45320547 ttcttgcattggtataccggagaaggaatggatgaaatggaatttactgaagcagaaagcaatatgaatgatcttgttgctgaatatcaaca 45320638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 11731903 - 11731826
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgt 78  Q
    |||||||||||||||||| ||||| |||||||| || ||||||||||||||||||||||| |||||||||||||||||    
T  11731903 tttcttgcattggtacactggtgagggaatggacgaaatggagttcactgaggctgagagtaacatgaatgatcttgt 11731826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 45452465 - 45452322
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    ||||||||||||||| || || || || ||||||||||||||||| ||||| || || |||||||||||||| ||||| || || || || || || |||    
T  45452465 tttcttgcattggtatactggagagggtatggatgagatggagtttactgaagcagaaagcaacatgaatgaccttgtctcagagtaccagcaataccaa 45452366  T
Q  101 gatgctactgcagaggaggatgagtatgaagatgaagaggagga 144  Q
    |||||||||||||| || || | ||||||  ||||||| |||||    
T  45452365 gatgctactgcagatgaagaggggtatgactatgaagatgagga 45452322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 34841839 - 34841949
Alignment:
Q  1 tttcttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaatgatcttgtgtcggaatatcaacagtatcaa 100  Q
    |||||||||||||||||| |||||||| |||||||| ||||| ||||| || || ||||||||||||||||| || ||||| || || || ||||| ||     
T  34841839 tttcttgcattggtacactggtgaaggcatggatgaaatggaattcacagaagcagagagcaacatgaatgacctcgtgtctgagtaccagcagtaccag 34841938  T
Q  101 gatgctactgc 111  Q
    ||||| |||||    
T  34841939 gatgccactgc 34841949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 53146055 - 53145991
Alignment:
Q  5 ttgcattggtacacaggtgaaggaatggatgagatggagttcactgaggctgagagcaacatgaa 69  Q
    ||||||||||| || || || ||||||||||||||||||||||| ||||| || || ||||||||    
T  53146055 ttgcattggtatactggggagggaatggatgagatggagttcacggaggcagaaagtaacatgaa 53145991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University