View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414-Insertion-13 (Length: 163)
Name: NF4414-Insertion-13
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 29988541 - 29988670
Alignment:
| Q |
8 |
actagagcacatcacacatgaagtttcaatgttggaatcaattatacctctgcacgacgtcagtctagtttggatcaatggaatgttgttgatttattgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29988541 |
actagagcacatcacacatgaagtttcaatgttggaatcaattatacctctgcacgacgtcagtctagtttggatcaatggaatgtagttgatttattgc |
29988640 |
T |
|
| Q |
108 |
attcgaatttcaaacacactttttgtcaaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29988641 |
attcgaatttcaaacacactttttgtcaaa |
29988670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 153
Target Start/End: Original strand, 44148821 - 44148854
Alignment:
| Q |
120 |
aacacactttttgtcaaaatcaattttacaaaat |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
44148821 |
aacacacttttagtcaaaatcaattttacaaaat |
44148854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 156
Target Start/End: Complemental strand, 7601913 - 7601881
Alignment:
| Q |
124 |
cactttttgtcaaaatcaattttacaaaattaa |
156 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
7601913 |
cacttttagtcaaaatcaattttacaaaattaa |
7601881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University