View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414-Insertion-14 (Length: 134)
Name: NF4414-Insertion-14
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414-Insertion-14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 37928387 - 37928514
Alignment:
| Q |
8 |
gcacttgtaggctgtctctgtattgttcctcctgcaagtgtgccatttattgtttttgttattccttgattgcaagattgaaggnnnnnnnac-tttgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
37928387 |
gcacttgtaggctgtctctgtattgttcctcctgcaagtgtgccatttattgtttttgttattccttgattgcaagattgaaggtttttttacttttgag |
37928486 |
T |
 |
| Q |
107 |
ttcggtttgcacgattctttggtttcgg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37928487 |
ttcggtttgcacgattctttggtttcgg |
37928514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University