View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414-Insertion-16 (Length: 95)
Name: NF4414-Insertion-16
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414-Insertion-16 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 1e-41; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 6 - 95
Target Start/End: Original strand, 43614869 - 43614958
Alignment:
| Q |
6 |
caatattctcatttatgaccatcttcaagatttttatgctttcattattggggtacgtagtacattattttaattattctctaatcttta |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614869 |
caatattctcatttataaccatcttcaagatttttatgctttcattattggggtacgtagtacattattttaattattctctaatcttta |
43614958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 8e-21
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 43609562 - 43609612
Alignment:
| Q |
10 |
attctcatttatgaccatcttcaagatttttatgctttcattattggggta |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43609562 |
attctcatttatgaccatcttcaagatttttatgctttcattattggggta |
43609612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 43603153 - 43603203
Alignment:
| Q |
10 |
attctcatttatgaccatcttcaagatttttatgctttcattattggggta |
60 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
43603153 |
attctcatttaagaccatcttcaagatttttatgctttcactatttgggta |
43603203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University