View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414-Insertion-17 (Length: 93)
Name: NF4414-Insertion-17
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414-Insertion-17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 6 - 93
Target Start/End: Complemental strand, 4696361 - 4696274
Alignment:
| Q |
6 |
cattaaatatatggatatatgtttgatcattatctattctttgattcaatgtaaaacttctaacttacatttaacacgttaactaatg |
93 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4696361 |
cattgaatatatggatatatgtttgatcattatctcttctttgattcaatgtaaaacttctaactcacatttaacacgttaactaatg |
4696274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University