View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_high_13 (Length: 300)
Name: NF4414_high_13
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 292
Target Start/End: Complemental strand, 42812391 - 42812114
Alignment:
| Q |
15 |
aattagtttaccttataatggccttgtattatcatcttttaaattttgaaatcagctcacagctcgtctttaccaaattgaaattcaaccctttagtcct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812391 |
aattagtttaccttataatggccttgtattatcatcttttaaattttgaaatcagctcacagctcgtctttaccaaattgaaattcaaccctttagtcct |
42812292 |
T |
|
| Q |
115 |
ccttaatacgactgtaaaatccctccctttactctttttggattggggaaacataagtagttaggttcttttgtatgcttgtggtgctactaatctgtca |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42812291 |
ccttaatatgactgtaaaatccctccctttactctttttggattggggaaacataagtagttaggttcttttgtatgcttgtggtgctaataatctgtca |
42812192 |
T |
|
| Q |
215 |
gaggaatatgatgcataactgagtctatcattcagcataaacactgcccatattttgatgatttattgcagaattatc |
292 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42812191 |
gaggaatatgatgcataactgagtttatcattcagcataaacactgcccatattttgatgatttattgcagaaatatc |
42812114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University