View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_low_12 (Length: 315)
Name: NF4414_low_12
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 308
Target Start/End: Original strand, 35884481 - 35884770
Alignment:
| Q |
16 |
ggaagaagattcaatagtgaatgtatttggtagttatgtgattgcttgatttataagtggagcataaaatggatttaggtgtgcagtatatttacttgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35884481 |
ggaagaagattcaatagtgaatgtatttggtagttatgtgattgcttgatttatatgtggagaataaaatggatttaggtgtgcagtatatttacttgag |
35884580 |
T |
 |
| Q |
116 |
tacgaactagaaggaaatttcttgaattttaaagagctgttccataatcttagtgacatacttgcccaaccaacatcaaaatcaaaatgaatttaattta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35884581 |
tacgaactagaaggaaatttcttgaattttaaagagctgttccataatcttagtgacatacttgcccaaccaacatcaaaatcaaaatgaatttaattta |
35884680 |
T |
 |
| Q |
216 |
tagtaacaaaattttaaacatacaattgacttaccttatcagaagaagatgactaccaatgtaattttggatggtagttgtatgcctttgctt |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35884681 |
tagtaacaaaattttacacatacaattgacttaccttatc---agaagatgactaccaatgtaattttggatggtagttgtatgtctttgctt |
35884770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University