View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_low_13 (Length: 313)
Name: NF4414_low_13
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 313
Target Start/End: Complemental strand, 40760549 - 40760253
Alignment:
| Q |
17 |
acaaggctgtactactggttaaatacaattgtgttacacttcatgaagcctgtcttccgagaggtcacttggttgtagtctaacttttcagtcttgagga |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40760549 |
acaaggctgtaatactggttaaatacaattgtgttacacttcaaaatgcctgtctcccgagaggtcacttggttgtagtctaacttttcagccttgagga |
40760450 |
T |
 |
| Q |
117 |
actcggttcgagacttgggcactgggtgaagagaagaaagtgaaagaaaagaaacatgaaggaaattgctctttaggcaccaacttcaaacatatgaggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40760449 |
actcggttcgagacttgggcactgggtgaagagaagaaagtgaaagaaaagaaacatgaaggaaattgctctttaggcaccaacttcaaacatatgaggt |
40760350 |
T |
 |
| Q |
217 |
atttcaaaatacctctcnnnnnnnnactctctaaagtttggttcttgttctgttaccagtttgaaattggttatgaagatggaagtgtggatattct |
313 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40760349 |
atttcaaaatacctctcttttttttactctctaaagtttggttcttgttctgttaccagtttgaaattggttatgaagatggaagtgtggatattct |
40760253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University