View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_low_15 (Length: 286)
Name: NF4414_low_15
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_low_15 |
 |  |
|
| [»] chr1 (228 HSPs) |
 |  |
|
| [»] scaffold0083 (2 HSPs) |
 |  |  |
|
| [»] scaffold0498 (2 HSPs) |
 |  |  |
|
| [»] scaffold0196 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (2 HSPs) |
 |  |  |
|
| [»] scaffold0444 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0031 (3 HSPs) |
 |  |  |
|
| [»] scaffold0004 (4 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (5 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0572 (1 HSPs) |
 |  |  |
|
| [»] scaffold1532 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0340 (2 HSPs) |
 |  |  |
|
| [»] scaffold0945 (2 HSPs) |
 |  |  |
|
| [»] scaffold0320 (2 HSPs) |
 |  |  |
|
| [»] scaffold0132 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (3 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0249 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0343 (2 HSPs) |
 |  |  |
|
| [»] scaffold0096 (2 HSPs) |
 |  |  |
|
| [»] scaffold1063 (2 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0672 (1 HSPs) |
 |  |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0214 (2 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 228)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 18542249 - 18541987
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttatannnnnnnnnctt |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||||||||| ||| |
|
|
| T |
18542249 |
ttctgttagtcaacatgacattttgcaaataccccccctgaagttttgcacttatttacaaaatgccccc-gaacttaaaaatttatatatttttttctt |
18542151 |
T |
 |
| Q |
118 |
cttatccttgacttaagacctatgagttgtatgtgaactaaatgatttccttagttggttaccaatgaagaaaacttcaaagaacttttcaggcataatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18542150 |
cttatccttgacttaagacctatgagttgtatgtgaactaaatggtttccttagttggttaccaatgaagaaaacttcaaagaacttttcaggcataatc |
18542051 |
T |
 |
| Q |
218 |
aattttggcagtcataatatcaattcttttttaactaattgaatacgactttgaattttagctagcttt |
286 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18542050 |
aattttggcactcatagta-----tcttttttaactaattgaatacgactttgaaagttagctagcttt |
18541987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 52869784 - 52869869
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52869784 |
ttctgttagtcaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
52869869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 26615055 - 26615141
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
26615055 |
cttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaatttgaaattttata |
26615141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 32186292 - 32186206
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
32186292 |
cttctgttagtcaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaatttgaaaatttat |
32186206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1799764 - 1799679
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1799764 |
ttctgttagttaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
1799679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17273041 - 17273126
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17273041 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17273126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26537753 - 26537668
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
26537753 |
ttctgttagtcaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccctcgaacttaaaaatttata |
26537668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31196776 - 31196691
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31196776 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
31196691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 31434755 - 31434840
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31434755 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
31434840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 43214595 - 43214683
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43214595 |
cttctgttagtcaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
43214683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 27235141 - 27235054
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || |||||| |||||||||| |
|
|
| T |
27235141 |
cttctgttagtcaacatgacattttgcaaataccaccctgaagttttgcacttatgtgcaaaatgcctcctgaacttaaaaatttata |
27235054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 32815055 - 32814968
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32815055 |
cttctgttagtcaacatgatgtttttcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
32814968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 20898640 - 20898726
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20898640 |
ttctgttagtgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20898726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21247510 - 21247424
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
21247510 |
ttctgttagtcaacatgatattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttata |
21247424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23703808 - 23703722
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
23703808 |
ttctgttagtcaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttata |
23703722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 40315554 - 40315472
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| |||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40315554 |
tgttagtcaacatgacgttttgcaaataccccgtgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
40315472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41115791 - 41115705
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41115791 |
ttctgttagtgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41115705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 42233615 - 42233529
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| | ||||||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
42233615 |
cttctgttagtcaacatgacgttttgcaaatacctcatgaagttttgcacttatgtgcaaaatgccacctgaacttgaaaatttata |
42233529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45141594 - 45141680
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt-gaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
45141594 |
ttctgttagtcaacatgacgttttgcaaataccccctggagttttgcacttatgtgcaaaatgccccctgaacttggaaaatttata |
45141680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17273669 - 17273584
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17273669 |
ttctgttagtgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17273584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31676394 - 31676309
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||| |||||||||| |
|
|
| T |
31676394 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaacgccccccaaacttaaaaatttata |
31676309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32832403 - 32832318
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
32832403 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
32832318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42246907 - 42246822
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
42246907 |
ttctgttagtgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
42246822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 51001000 - 51000915
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
51001000 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttcaaaatttata |
51000915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29330042 - 29329955
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29330042 |
ttctgttagtcaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29329955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 35156128 - 35156052
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35156128 |
caacatgacgttttgcaaatatccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
35156052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 16798224 - 16798137
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| ||||||||| ||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
16798224 |
cttctgttagtcaacatgacgttttgcaaatacccccctgaagtttttcacttatgtgcaaaatgtccccagaacttgaaaatttata |
16798137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3898412 - 3898326
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3898412 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3898326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4632394 - 4632308
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4632394 |
ttctgttagtgaacatgactttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
4632308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7436670 - 7436756
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7436670 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7436756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7437295 - 7437209
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7437295 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7437209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 10386962 - 10387048
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
10386962 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
10387048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11992112 - 11992198
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11992112 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11992198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 11992727 - 11992653
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11992727 |
aacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11992653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13242320 - 13242406
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13242320 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13242406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16265452 - 16265538
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16265452 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
16265538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25227530 - 25227616
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25227530 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25227616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30751253 - 30751339
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30751253 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30751339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30753064 - 30753150
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30753064 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30753150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35894191 - 35894277
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
35894191 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
35894277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 35894818 - 35894732
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
35894818 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
35894732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37613583 - 37613497
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37613583 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37613497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 46804514 - 46804428
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
46804514 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
46804428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 51619534 - 51619620
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
51619534 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
51619620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 23 - 88
Target Start/End: Complemental strand, 13534062 - 13533997
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13534062 |
tgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccccc |
13533997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22775564 - 22775649
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
22775564 |
ttctgttagtgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
22775649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 29329416 - 29329501
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
29329416 |
ttctgttagtgaacatgatgttttgcaaataccccctgaagttttgcacttatatgcaaaatgccctccaaacttaaaaatttata |
29329501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37587751 - 37587666
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
37587751 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
37587666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8384107 - 8384020
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8384107 |
ttctgttagtgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8384020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9061182 - 9061095
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9061182 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9061095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18053815 - 18053902
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18053815 |
ttctgttagtgaacatgacgttttgcaaatacttcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
18053902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29358365 - 29358278
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29358365 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29358278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 31058653 - 31058577
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31058653 |
cttctgttagtcaacatgacgttttgcaaatacccccataaagttttgcacttatttgcaaaatgccccctgaactt |
31058577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37276338 - 37276251
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37276338 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37276251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38788558 - 38788471
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38788558 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38788471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 4512728 - 4512795
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4512728 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccc |
4512795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 6783263 - 6783338
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| || |||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6783263 |
aacatgacgttttgcaaatactcctctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
6783338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 46294566 - 46294649
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
46294566 |
tgttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
46294649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 6783841 - 6783767
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
6783841 |
aacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttata |
6783767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 10387589 - 10387503
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
10387589 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
10387503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 14403962 - 14404028
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14403962 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
14404028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 25228158 - 25228072
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||| ||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25228158 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagctttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25228072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 25376859 - 25376941
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
25376859 |
tgttagtcaacatcacgttttgcaaataccccctgaagttttgcaattatgtgcaaaatgcctcttgaacttgaaaatttata |
25376941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26442024 - 26442110
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26442024 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26442110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 28297282 - 28297196
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||| || |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
28297282 |
ttctgttagtaaacatgacgttttgcaaatacccccttgaagttttacagttatgtgcaaaatgccccctgaacttgaaaatttata |
28297196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 29487412 - 29487493
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
29487412 |
tgttagctaacatgacgttttgcaaataccccct-aagttttgcacttatgtgcaaaatgtcccctgaacttgaaaaattata |
29487493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 29674432 - 29674506
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
29674432 |
aacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttata |
29674506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37538476 - 37538390
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37538476 |
ttctgttagtgaacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37538390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 37612957 - 37613043
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
37612957 |
ttctgttagtgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
37613043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43760258 - 43760172
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||||||| ||||||||||| ||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
43760258 |
ttctgttagtcaacatgacgtttttcaaatacccccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttata |
43760172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 44210052 - 44209975
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44210052 |
cttctgttagtcgacatgatattttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccgaactt |
44209975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 46803888 - 46803974
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||| ||||| |
|
|
| T |
46803888 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttata |
46803974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 4469591 - 4469667
Alignment:
| Q |
31 |
aacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4469591 |
aacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
4469667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13265347 - 13265263
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
13265347 |
ttctgttagtgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
13265263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 27234548 - 27234621
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
27234548 |
tgttaggcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctccctaaacttga |
27234621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36304135 - 36304220
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36304135 |
ttctgttagtgaacatgacgttttgcaaatatcctttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36304220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44432249 - 44432164
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||| | ||||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
44432249 |
ttctgttagtcaacataacgttttgcaaataccccataaagttttgcacttatgtgaaaaatgccccctaaacttgaaaatttata |
44432164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 47433644 - 47433728
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
47433644 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
47433728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 52870632 - 52870547
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| || |||| |||||||||| | | ||| ||||||||||||| |
|
|
| T |
52870632 |
ttctgttagtcaacatgacgttttgcaaataccccctgaagttttacatttatgtgcaaaatgctctctgaatttgaaaatttata |
52870547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 22 - 105
Target Start/End: Complemental strand, 8897642 - 8897558
Alignment:
| Q |
22 |
ctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||| || ||||||||||||||||| |||||||| ||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8897642 |
ctgttagtaaacataacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttata |
8897558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13698302 - 13698215
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| ||||||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
13698302 |
ttctgttagtgaacatgacaatttgcaaataccccccctgaagttttccacttatgtgcaaaatgccccatgaacttgaaaatttata |
13698215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 18611275 - 18611359
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||| ||||||| |||||| | ||| |||||||||||||||||| |
|
|
| T |
18611275 |
ttctgttagtaaacatgacgttttgcaaatatcccctgaagttttacacttatgtgcaaattcccctccgaacttgaaaatttat |
18611359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 27234358 - 27234445
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
27234358 |
ttctgttagagaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
27234445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 31196150 - 31196237
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
31196150 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
31196237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 31675509 - 31675596
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
31675509 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
31675596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38457327 - 38457240
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
38457327 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
38457240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38787658 - 38787745
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38787658 |
ttctgttagtgaacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38787745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 48720893 - 48720980
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || ||||||||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
48720893 |
ttctgttagtaaacatgacgttttgcaaatatccgccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttata |
48720980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 49204214 - 49204127
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
49204214 |
ttctgttagtgaacatgacgttttgcaaataccccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
49204127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 24250545 - 24250620
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
24250545 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
24250620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 31050086 - 31050173
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||| |||||||||||| |||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
31050086 |
cttctgttagtcaacatgaagttttacaaatacccccatgaagttttgcatttatgtgcaaaatgccccacgaatttgaaaatttata |
31050173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 32831775 - 32831850
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32831775 |
ttctgttagtgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaactt |
32831850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 37275721 - 37275796
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37275721 |
aacacgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37275796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 47434258 - 47434183
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
47434258 |
aacatgacgttttgcaaatacccccctgaacttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
47434183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 48803500 - 48803575
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
48803500 |
aacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttgaaaatttata |
48803575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4470208 - 4470122
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
4470208 |
ttctgttagtgaacatgacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttata |
4470122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7287666 - 7287752
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||| ||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
7287666 |
ttctgttagtaaacataacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccctgaacttgaacatttata |
7287752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 8897054 - 8897128
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
8897054 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
8897128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13242964 - 13242878
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||| |||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13242964 |
ttctgttagtgaacataacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttata |
13242878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16834489 - 16834575
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||| ||||||| | ||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
16834489 |
ttctgttagtcaacataacgttttgcaattaccccccttaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
16834575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21040934 - 21040848
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||||||||||||||| ||| ||||||||||| ||||| ||| |||||| |
|
|
| T |
21040934 |
ttctgttagtgaacatgacattttgcaaataccgccctaaagttttgcacttatgtgcgaaatgccccccaaacttaaaattttata |
21040848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 22389169 - 22389083
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||| |||||||||| |||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
22389169 |
ttctgttagtcaacatgatgttttgcaaatagccccctaaagttttgcaattatgtgtaaaataccccccgaacttgaaaatttata |
22389083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24982770 - 24982856
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24982770 |
ttctgttagtgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
24982856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 30634432 - 30634505
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||| |
|
|
| T |
30634432 |
aacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatg-ctcccgaacttaaaaatttata |
30634505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31435488 - 31435402
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
31435488 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttata |
31435402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38456699 - 38456785
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
38456699 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacctccaaacttaaaaatttata |
38456785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 42246303 - 42246376
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
42246303 |
aacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
42246376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 44431319 - 44431393
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| |||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
44431319 |
aacatgacgttttgcaaatactccctgaagttttgtacttatgtgcaaaataccccatgaacttgaaaatttata |
44431393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 49203320 - 49203406
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||||||||||||||| |||||| |||||| |||||||| ||||| |||||||||| |
|
|
| T |
49203320 |
ttctgttagcgaacaagacgttttgcaaataaccccctgaagttttgtacttatgtgcaaattgccccccaaacttaaaaatttata |
49203406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 51000093 - 51000159
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51000093 |
ttctgttagtgaacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
51000159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 52359428 - 52359501
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
52359428 |
aacatgacgttttgcaaataccccctgaagttttccacttatgtgcaaaatg-cccccaaacttaaaaatttata |
52359501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1798889 - 1798974
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||| ||||||||||||||||| |||||||| |||| || ||||||||||||| |
|
|
| T |
1798889 |
ttctgttagtcaacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccccataaatttgaaaatttata |
1798974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6918791 - 6918706
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||||||||||||||||| | ||||||||||||||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
6918791 |
ttctgttagtgaatatgacattttgcaaataccgtccaaagttttgcacttatgtgcaaaatgcctcccgaacttaaaaatttata |
6918706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 26615776 - 26615692
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||| ||||| |||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
26615776 |
tgttagtcaaaatgacgttttgcaaataccccccctgaagttttgcacttatgagcaaaatgccccttgaacttgaaaatttata |
26615692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29675048 - 29674960
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgcc-ccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||| ||||| |||||||||| |
|
|
| T |
29675048 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttata |
29674960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 34556943 - 34557028
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||| |||||||||||||||||||| |||||| ||||||||| || || || || |||||||||| |
|
|
| T |
34556943 |
ttctgttagtcaacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaatgtccaccaaatttaaaaatttata |
34557028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 17826966 - 17826903
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| |
|
|
| T |
17826966 |
tgttagtcaacatgacattttgcaaatacccc-tgaagttttgtacttatgtgcaaaatgccccc |
17826903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18054444 - 18054357
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18054444 |
ttctgttagtgaacatgatgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttata |
18054357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 29357482 - 29357557
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaact |
93 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29357482 |
ttctgttagtgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaact |
29357557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 40116909 - 40116842
Alignment:
| Q |
40 |
ttttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
40116909 |
ttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgtccctcgaacttgaaaatttata |
40116842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 43680501 - 43680574
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
43680501 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaact--aaaatttata |
43680574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45508015 - 45508101
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
45508015 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
45508101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 52360299 - 52360212
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
52360299 |
ttctgttagtgaacatgacgttttgaaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
52360212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 11184548 - 11184618
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
11184548 |
atgacgttttgcaaatacccactgaagttttgcacttatatgcaaaatg-tccccgagcttgaaaatttata |
11184618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 12770202 - 12770277
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
12770202 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
12770277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 18611875 - 18611788
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||||||||||||| | ||||||||||| | ||||| |||||||||| |
|
|
| T |
18611875 |
cttctgttagtgaacatgaagttttgcaaatatccccctgaagttttgcacttatgtacaaaatgcccctcaaacttaaaaatttata |
18611788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 25859577 - 25859502
Alignment:
| Q |
31 |
aacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
25859577 |
aacatgacgttttacaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttacaaatttata |
25859502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 32074661 - 32074586
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||| | ||||| ||||| |||| |
|
|
| T |
32074661 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatatata |
32074586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 37587135 - 37587210
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||| ||| || || |||||||||| |
|
|
| T |
37587135 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaatttaaaaatttata |
37587210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 39364972 - 39365047
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
39364972 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaaatttata |
39365047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 44397487 - 44397404
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||| |||||||||||||||| |||||||||||| || ||||| ||||||| |
|
|
| T |
44397487 |
ttctgttagtgaacataacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt |
44397404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 48803895 - 48803820
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
48803895 |
aacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
48803820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1024182 - 1024096
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| ||||| ||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
1024182 |
ttctgttagtgaacatgacgttttacaaatactcccctaaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttata |
1024096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 6917279 - 6917353
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||| |||| ||||||||||| | ||||||| |||||||||| |
|
|
| T |
6917279 |
aacatgacgttttgcaaatactccctaaagttttgcatttatgtgcaaaatgcctcacgaacttaaaaatttata |
6917353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 11202172 - 11202118
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccc |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
11202172 |
aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccc |
11202118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 20899266 - 20899181
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||| ||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
20899266 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
20899181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 30753963 - 30753878
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||| | ||||| ||||| |||||||||| |
|
|
| T |
30753963 |
ttctgttagagaacatgacgttttgcaaatacccgcctgaagttttgcacttatgtgcaaaa-ggcccccaaacttaaaaatttata |
30753878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37813107 - 37813022
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||| ||||||||||| ||||| |||||||||| |
|
|
| T |
37813107 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaacttaaaaatttata |
37813022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42148498 - 42148583
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
42148498 |
ttctgttagtgaacataacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
42148583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 46295488 - 46295402
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||| |||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
46295488 |
ttctgttagttaacatgatgttttgcaaatacccatctgaagttttgtacttatgtgcaaaatgccccctggacttgaaaatttata |
46295402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 25 - 105
Target Start/End: Original strand, 16797266 - 16797346
Alignment:
| Q |
25 |
ttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||| |||||||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
16797266 |
ttagtcaacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatg-cccctaaacttgaaaatttata |
16797346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 22388459 - 22388547
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||||||||||| || |||||| ||||||||| |||||||||| |
|
|
| T |
22388459 |
cttctgttagttaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgttaaatgcttcccgaacttaaaaatttata |
22388547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 22776149 - 22776065
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| || ||||||||| ||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
22776149 |
ttctgttagtgaacatgacgttttgcaaatacccactaaagttttgctcttatgtgcaaaatgc-ccccaaacttaaaaatttata |
22776065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 48751678 - 48751735
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
48751678 |
caacaagacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccc |
48751735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 51 - 104
Target Start/End: Complemental strand, 49216926 - 49216873
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
49216926 |
ccccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttat |
49216873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 4514111 - 4514035
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||||||| ||||||||| |||||| ||||| |||||||||| |
|
|
| T |
4514111 |
aacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgtccccccaaacttaaaaatttata |
4514035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13149618 - 13149705
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| |||||||||||||||||| |||||||||| || | ||||| |||||||||| |
|
|
| T |
13149618 |
ttctgttagtgaatatgacgttttgcaaatacccctcctgaagttttgcacttatgtgcaaaatgcgcctcaaacttaaaaatttata |
13149705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 20358069 - 20358136
Alignment:
| Q |
40 |
ttttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
20358069 |
ttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
20358136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 20561886 - 20561819
Alignment:
| Q |
40 |
ttttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
20561886 |
ttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
20561819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 32536319 - 32536379
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
32536319 |
caaataccccctgaaattttgcccttatgtgcaaaatgccccctaaacttgaaaatttata |
32536379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36305037 - 36304950
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||| ||| ||| ||||||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36305037 |
ttctgttagagaacatgacgttttgcatatatccctcctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
36304950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 37812479 - 37812566
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||| | || |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37812479 |
ttctgttagtgaacatgacgttttgcaaatactccccttaaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37812566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38833629 - 38833716
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||| ||||||||||| || ||||||||||| ||||| |||||||||| |
|
|
| T |
38833629 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagatttgcacttatgtgtaaaatgccccctaaactttaaaatttata |
38833716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 43215308 - 43215224
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||| || |||||||||| ||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43215308 |
tctgttagtcaacatgacgttagacaaataccccatgaagttttatacttatgtgcaaaatgccccccaaacttaaaaatttata |
43215224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 43282025 - 43281949
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||||| | ||||||| |||||||||| |
|
|
| T |
43282025 |
caacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcttctcgaacttaaaaatttata |
43281949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 44396590 - 44396658
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
44396590 |
ttctgttagtgaacatgacgttttacaaatacccccttgaagttttgcacttatgtgcaaaatgccccc |
44396658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 48721477 - 48721401
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgcccc-ccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||| || ||||| |||||||||| |
|
|
| T |
48721477 |
aacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgcccctccaaacttaaaaatttata |
48721401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 8383488 - 8383565
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc---ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
8383488 |
aacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttata |
8383565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 98
Target Start/End: Complemental strand, 18807631 - 18807552
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| |||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
18807631 |
ttctgttagttaacatgacgttttgtaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaa |
18807552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 105
Target Start/End: Original strand, 27134429 - 27134480
Alignment:
| Q |
54 |
cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
27134429 |
cctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
27134480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 38834257 - 38834190
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
38834257 |
ttctgttagtgaacatgacgttttgcaaataccccactgaagttttgcacatatgtgcaaaatgcccc |
38834190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 52870045 - 52870119
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
52870045 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
52870119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4631770 - 4631856
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
4631770 |
ttctgttagtgaacatgacgttttgtaaatacccccctaaagttttgcacttatgtgcaaaatgaccccaaaacttaaaaatttata |
4631856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 8742578 - 8742524
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
8742578 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
8742524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 9055735 - 9055821
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||| |||| |||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
9055735 |
ttctgttagtgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcttcccaaacttaaaaatttata |
9055821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 11707442 - 11707388
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
11707442 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
11707388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 13697724 - 13697796
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
13697724 |
aacatgatgttttgcatatacctcctgaagttttgcacttatgtgcaaaatg-cccccgaactt-aaaatttata |
13697796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 28296686 - 28296760
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||| |||| |||||||||| |||||||||||||||||| |||||||||||| || ||||| ||||||||| |
|
|
| T |
28296686 |
aacatgaagttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttat |
28296760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32814344 - 32814429
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||| ||||||||||| |||||| |||||| |||||||| ||||| |||||||||| |
|
|
| T |
32814344 |
ttctattagtcaacatgatcttttgcaaatacccctctgaagttttgaacttatgtgcaaa-tgccccccaaacttaaaaatttata |
32814429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 36723985 - 36723931
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
36723985 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
36723931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38617928 - 38617842
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||| |||| |||||||||||||||| |||||||| |||| | ||||| |||||||||| |
|
|
| T |
38617928 |
ttctgttagtgaacatgatgttttgcaaatacaccccagaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttata |
38617842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 42149123 - 42149061
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaat |
81 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
42149123 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaat |
42149061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 43505956 - 43505902
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
43505956 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
43505902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 48731562 - 48731508
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
48731562 |
ccccctgaagttttgcacttatgcgcaaaatgccctctgaacttgaaaatttata |
48731508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 9034559 - 9034498
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
9034559 |
caaatacccccatgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
9034498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 17825947 - 17826024
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||| | |||||||||||||||||| | |||||||| || |||||||| |
|
|
| T |
17825947 |
cttctgttagtcaagatgacgttttgcaaatactcgctgaagttttgcacttatgtacaaaatgctccttgaacttga |
17826024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 35392638 - 35392691
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
35392638 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
35392691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 45142467 - 45142388
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||| |||||||| || |||| ||||||||| ||||| |||||||||||| |
|
|
| T |
45142467 |
ttctattagtcaacatgacgttttgcaaataccccc-gaagttttacagttatgtgcaaaatg-ccccctaacttgaaaatt |
45142388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 45508629 - 45508552
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaat-gcccccc-gaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||||| ||||| |||||||||| |
|
|
| T |
45508629 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatcgccccccaaaacttaaaaatttata |
45508552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 50642944 - 50643008
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || |||||| ||||| ||||||||||| |||| |
|
|
| T |
50642944 |
ttttgcaaataccctctgaagttttgcacttatgtgtaaaatg-cccccaaacttgaaaatgtata |
50643008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 4212912 - 4212980
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4212912 |
ttctgttagtgaacatgatgttttgcaaatatcccccagaagttttgcacttatgtgcaaaatgccccc |
4212980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 13158802 - 13158734
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
13158802 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccc |
13158734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16266551 - 16266637
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||| |||||||||||||| | ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
16266551 |
ttctgttagtgaacatgacgttttgcaaatatccccccagaagttttgcacttgtgtgcaaaatg-cccccaaacttaaaaatttata |
16266637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29487952 - 29487865
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||| ||||||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
29487952 |
ttctgttagtcaacaagacgttttgcaaataccccccctgaagttttgcacttatgcgcaaaattccctgtgaacttaaaaatttata |
29487865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 45217737 - 45217678
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
45217737 |
caaataccccctgaaattttgcacttatgtgcaaaatg-cccctaaacttgaaaatttata |
45217678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 51547264 - 51547188
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttg |
95 |
Q |
| |
|
||||||||| ||||| || |||| ||||||||||| ||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
51547264 |
ttctgttagtgaacataacgttttccaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttg |
51547188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 26189971 - 26189897
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| || || |||||||||| ||||||| |||||||| ||||| |||||| |||||||||| |
|
|
| T |
26189971 |
caacatgacgttttgcaattatcctctgaagttttacacttatatgcaaaataccccc-gaacttaaaaatttata |
26189897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 105
Target Start/End: Original strand, 43281358 - 43281416
Alignment:
| Q |
46 |
aaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||||||||||||||||||||| ||| ||||| ||||||||||| |||||||||| |
|
|
| T |
43281358 |
aaatgccccctgaagttttgcacttatgtgc-aaatggcccccgaacttaaaaatttata |
43281416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1023564 - 1023649
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||| |||| ||||||| | ||| | ||||| |||||||||| |
|
|
| T |
1023564 |
ttctgttagtgaacatgac-ttttgcaaatacccccctgaagttttgcaattatgtgcaaaaagtccctcaaacttaaaaatttata |
1023649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 9033723 - 9033777
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
9033723 |
ccccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttata |
9033777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 9680966 - 9680912
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
9680966 |
ccccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttata |
9680912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 10373694 - 10373748
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
10373694 |
ccccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttata |
10373748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 14404509 - 14404436
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||||||||||| | ||||||||| ||||||||| |||||||||| |
|
|
| T |
14404509 |
aacatgactttttgcaaatacctcctaaagttttgcacttttgtgcaaaatg-tccccgaactaaaaaatttata |
14404436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 32537158 - 32537116
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
32537158 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccc |
32537116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 38623781 - 38623727
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
38623781 |
ccccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttata |
38623727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42413225 - 42413310
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||| | |||||||||| |||| ||||||||| |||||||| || |||||||||| |
|
|
| T |
42413225 |
ttctgttagtgaatatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatg-cccccgaatttaaaaatttata |
42413310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 43281298 - 43281367
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
43281298 |
ttctgttagttaatatgacgttttgcaaataccccccctgaagttttgcacttatgtgtaaaatgccccc |
43281367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 43594250 - 43594200
Alignment:
| Q |
22 |
ctgttagccaacatgacattttgcaaataccccctgaagttttgcacttat |
72 |
Q |
| |
|
||||||| |||||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
43594250 |
ctgttagtcaacatcacgttttgcaaataccgcctgaagttttgcacttat |
43594200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 103
Target Start/End: Complemental strand, 15926783 - 15926727
Alignment:
| Q |
46 |
aaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
15926783 |
aaataccccctgaaattttgcacttatgtgcaaaatg-cccctaaacttgaaaattta |
15926727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 26189045 - 26189110
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaat-accccctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| | || | ||||||||||||||||| ||||| |||| |
|
|
| T |
26189045 |
cttctgttagccaacatgacattttgcaattgtcctcttgaagttttgcacttatgtgcaagatgc |
26189110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 8741883 - 8741935
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
8741883 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
8741935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 10613820 - 10613750
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac---cccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||||| ||| || || |||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10613820 |
cttctgttagtcaatatcacgttttgcaaatacttccccctaaagttttgcacttatgtgcaaaatgcccc |
10613750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 19076366 - 19076279
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| |||| |||||| || |||||| |||||||| ||||| |||||||| ||||||| |
|
|
| T |
19076366 |
ttctgttagtcaacataacattttacaaatacccccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttata |
19076279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 19124256 - 19124169
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||| |||| |||||| || |||||| |||||||| ||||| |||||||| ||||||| |
|
|
| T |
19124256 |
ttctgttagtcaacataacattttacaaatacccccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttata |
19124169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 27326973 - 27326925
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27326973 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaa |
27326925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 35155242 - 35155293
Alignment:
| Q |
53 |
ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
35155242 |
ccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
35155293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 36723441 - 36723493
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
36723441 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
36723493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 44432745 - 44432685
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||| || |||||||||||||||| |
|
|
| T |
44432745 |
caaataccccctgaaattttgcacttatgtccaaaatgctccataaacttgaaaatttata |
44432685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 11706871 - 11706930
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
11706871 |
caaatacccccatgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
11706930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 33740899 - 33740837
Alignment:
| Q |
45 |
caaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
33740899 |
caaataccccttctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttata |
33740837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 34557866 - 34557799
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccc |
85 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||| ||| || |||| |||||||||| |||||||||||| |
|
|
| T |
34557866 |
cttctgttagtcaacatgacgttttggaaataaccctctaaagtcttgcacttatgtgcaaaatgccc |
34557799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 42128636 - 42128589
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
42128636 |
ttttgcaaatacctcctgaagttttgcacttatgtgcagaataccccc |
42128589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 44209230 - 44209296
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||| |||||| || ||| ||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
44209230 |
tgttagtcaacatcacgtttggcaaataccccccctgaagttttgcacttaagtgcaaaatgccccc |
44209296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 24482097 - 24482151
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
24482097 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttata |
24482151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 37327648 - 37327702
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
37327648 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatctata |
37327702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 46584914 - 46584968
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
46584914 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaattttgaaaatttata |
46584968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 51597017 - 51596930
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata---ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| |||||| ||||||||||||||| | |||||| ||| ||||||| |||||||||| |
|
|
| T |
51597017 |
ttctgttaatcaacatgacgttttgcaaatatccccccctaaagttttgcacttatgttcaaaat-accctcgaacttaaaaatttata |
51596930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 52580575 - 52580521
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| || ||||| |||||||||| |
|
|
| T |
52580575 |
ccccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaatttata |
52580521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 86
Target Start/End: Original strand, 43505391 - 43505432
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
43505391 |
caaataccccctgaaattttgcatttatgtgcaaaatgcccc |
43505432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 103
Target Start/End: Complemental strand, 44157125 - 44157076
Alignment:
| Q |
54 |
cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
44157125 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
44157076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 45216901 - 45216962
Alignment:
| Q |
45 |
caaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
45216901 |
caaataccctcctgaaattttgcacttatatgcaaaatgtcccctaaacttaaaaatttata |
45216962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 46585549 - 46585496
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
46585549 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttata |
46585496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 60 - 105
Target Start/End: Complemental strand, 50643563 - 50643519
Alignment:
| Q |
60 |
gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
50643563 |
gttttgcacttatatgcaaaatg-ccctcgaacttgaaaatttata |
50643519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 9680417 - 9680469
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
9680417 |
ccccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaattta |
9680469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 105
Target Start/End: Original strand, 10509647 - 10509702
Alignment:
| Q |
49 |
taccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
10509647 |
taccccctaaaattttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
10509702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 24480409 - 24480357
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
24480409 |
ccccctgaaattttgcgcttatgtgcaaaatgccccctaaacttaaaaattta |
24480357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 27326425 - 27326477
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
27326425 |
ccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaattta |
27326477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 40116180 - 40116228
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgca |
67 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
40116180 |
cttctgttagtcaacataacgttttgcaaatacccctcgaagttttgca |
40116228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 229)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 36111602 - 36111688
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
36111602 |
cttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
36111688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 12594696 - 12594783
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12594696 |
cttctgttagtcaacatgatgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
12594783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 21857733 - 21857820
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21857733 |
cttctgttagtcaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
21857820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 21913596 - 21913683
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21913596 |
cttctgttagtcaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
21913683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12595371 - 12595285
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
12595371 |
ttctgttagttaacatgacattttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
12595285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 23465745 - 23465819
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
23465745 |
aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttaaaaatttata |
23465819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 36112209 - 36112124
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
36112209 |
cttctgttagtcaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
36112124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6194246 - 6194331
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6194246 |
ttctgttagtgaacatgacattttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6194331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29246175 - 29246090
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29246175 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29246090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40145770 - 40145855
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
40145770 |
ttctgttagtaaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttata |
40145855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 17215912 - 17215834
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
17215912 |
tgttagtcaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatt |
17215834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 32860061 - 32860135
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32860061 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32860135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 34476171 - 34476245
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
34476171 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
34476245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34733273 - 34733187
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34733273 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
34733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 38575665 - 38575750
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
38575665 |
cttctgttagtcaacttgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaatttata |
38575750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 41611443 - 41611357
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
41611443 |
cttctgttagtcaacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccatccgaacttaaaaatttata |
41611357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6528313 - 6528398
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
6528313 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
6528398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22524424 - 22524508
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |||||||||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
22524424 |
ttctgttagtcaacatgacgttttgcaaataccccctaaagttttgcaattatgtgcaaaatg-cccccgaacttgaaaatttata |
22524508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23466360 - 23466275
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23466360 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttata |
23466275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41744864 - 41744779
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
41744864 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
41744779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 56280490 - 56280405
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
56280490 |
ttctgttagtaaacataacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgctccccgaacttgaaaatttata |
56280405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 56473723 - 56473658
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
56473723 |
ttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttata |
56473658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1614904 - 1614817
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1614904 |
ttctgttagttaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
1614817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 6644142 - 6644227
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
6644142 |
cttctgttagccaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatg--ccccaaacttgaaaatttata |
6644227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 17215062 - 17215145
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
17215062 |
tgttagtcaacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
17215145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1617965 - 1618051
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1617965 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttata |
1618051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3886126 - 3886040
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
3886126 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgctccccgaacttaaaaatttata |
3886040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6922810 - 6922724
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6922810 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6922724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 12800335 - 12800401
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccc |
85 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12800335 |
cttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccc |
12800401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 21310952 - 21311026
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21310952 |
aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttata |
21311026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23475882 - 23475796
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaat-gccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||| |||||||||| |
|
|
| T |
23475882 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatcgccccccaaacttaaaaatttata |
23475796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 24318629 - 24318555
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
24318629 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
24318555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 28255273 - 28255359
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
28255273 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
28255359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 30357230 - 30357144
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30357230 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30357144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 37998127 - 37998213
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37998127 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37998213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37998754 - 37998668
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37998754 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37998668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 40131151 - 40131225
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
40131151 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
40131225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41790169 - 41790083
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41790169 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41790083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 48613434 - 48613520
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
48613434 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgcccccctaacttaaaaatttata |
48613520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 50181377 - 50181463
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
50181377 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
50181463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 6644895 - 6644810
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||||||||||||||||| |||||||||| | |||||||| ||||||||| |
|
|
| T |
6644895 |
cttctgttagttaacatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgctctccgaacttaaaaatttat |
6644810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 36870945 - 36870868
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
36870945 |
ttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcatttatatgcaaaatgccccttgaacttgaa |
36870868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 47838075 - 47838160
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| | ||| ||||| |||||||||| |
|
|
| T |
47838075 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttata |
47838160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 55497224 - 55497151
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
55497224 |
aacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
55497151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 1195059 - 1195143
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
1195059 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta |
1195143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6259168 - 6259255
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6259168 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6259255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17607694 - 17607607
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17607694 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17607607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17971690 - 17971603
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
17971690 |
ttctgttagcgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
17971603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21659972 - 21659885
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21659972 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21659885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21861343 - 21861430
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21861343 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21861430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21861973 - 21861886
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21861973 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21861886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21917204 - 21917291
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21917204 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21917291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21917834 - 21917747
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21917834 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21917747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 27179919 - 27180006
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
27179919 |
ttctgttagtgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
27180006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 28255901 - 28255814
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
28255901 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
28255814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 917909 - 917984
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
917909 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
917984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 21858455 - 21858368
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||| |||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
21858455 |
cttctgttagtcaacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttata |
21858368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 21914318 - 21914231
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||| |||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
21914318 |
cttctgttagtcaacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttata |
21914231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22731797 - 22731722
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22731797 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22731722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 23161220 - 23161299
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
23161220 |
ttctgttagtcaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaa |
23161299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 25705386 - 25705473
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||| ||||||||||||||||| ||||||| | | |||||||||||||||||||| |
|
|
| T |
25705386 |
cttctgttagtcaatatgacgttttgcaaatacccccgtgaagttttgcacttatgtgcaaaaagtctcccgaacttgaaaatttata |
25705473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 55083468 - 55083385
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
55083468 |
tgttagtcaacataacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
55083385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6239092 - 6239006
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6239092 |
ttctgttagtgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6239006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6259796 - 6259710
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6259796 |
ttctgttagtgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6259710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6337033 - 6336947
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||| |||||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6337033 |
ttctgttagttaacatgacgtttttcaaataccctcctgaagttttgtacttatatgcaaaatgccccctgaacttgaaaatttata |
6336947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 9025097 - 9025023
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| || |||||||||||||||| |||||||| |||||| |||||||||||||||| |
|
|
| T |
9025097 |
aacatgacgttttgcaaatacctccagaagttttgcacttatatgcaaaataccccccaaacttgaaaatttata |
9025023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 20598819 - 20598905
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
20598819 |
ttctgttagtgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttata |
20598905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 27716275 - 27716190
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
27716275 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatg-accccgaacttgaaaatttata |
27716190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32826192 - 32826106
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32826192 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32826106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 33821211 - 33821297
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
33821211 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
33821297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34825418 - 34825332
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
34825418 |
ttctgttagtgaacatgacgttttgcaaatacacccctgaagttttgcacttatgtgcaaaatgccccccaaactcaaaaatttata |
34825332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 43420749 - 43420663
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || |||||||||| |||||| |||||| ||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
43420749 |
cttctgttagtcaacatcacgttttgcaaatcccccctatagttttacacttatgtgcaaaatgctccccgaacttgaaaatttata |
43420663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 44254774 - 44254860
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
44254774 |
ttctgttagagaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
44254860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44255351 - 44255263
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc---cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44255351 |
ttctgttagtgaacatgacgttttgcaaataccctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44255263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 48083068 - 48083154
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||| |||||||||||||||||| |||||||||||||| ||| || |||||||||| |
|
|
| T |
48083068 |
ttctgttagtcaacatgacgtcttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaatttaaaaatttata |
48083154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 48614049 - 48613975
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
48614049 |
aacatgatgttttgcaaataccccctgtagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
48613975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7861991 - 7862076
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||||||| |||||||||| ||||| |||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
7861991 |
ttctattagtcaacatgacactttgcaaatatcccctaaagttttgcacttacgtgcaaaatgtcccccgaacttaaaaatttata |
7862076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13994483 - 13994398
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||| | |||||||| |||||| ||||| ||| |||||| |
|
|
| T |
13994483 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttgtgtgcaaaataccccccaaacttaaaattttata |
13994398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 105
Target Start/End: Original strand, 18963432 - 18963517
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| ||||||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18963432 |
tctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttata |
18963517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 24 - 105
Target Start/End: Complemental strand, 23161947 - 23161867
Alignment:
| Q |
24 |
gttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||| || ||||||||||||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
23161947 |
gttagtcaacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgc-ccccgaactttaaaatttata |
23161867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 24792490 - 24792405
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |||||||| |||||| ||||| |||| ||||| |
|
|
| T |
24792490 |
ttctgttagtgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattata |
24792405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24815771 - 24815856
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |||||||| |||||| ||||| |||| ||||| |
|
|
| T |
24815771 |
ttctgttagtgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattata |
24815856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 29798121 - 29798037
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||| ||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
29798121 |
cttctgttagtcaacatgatgttttgcaaataccccctaaagttttacacttatgtgcaaaatgc-ccccgaacatgaaaatttat |
29798037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 29861039 - 29860955
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| || |||||| |||||||||||||| ||||||||||| ||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
29861039 |
tgttagtcagcatgacgttttgcaaataccctccctgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttata |
29860955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 30114022 - 30113946
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30114022 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30113946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36870223 - 36870306
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
36870223 |
ttctgttagtcaacataacgttttgcaaataccccctgaagtttt-cacttatgtgcaaaatg-cccccgaactttaaaatttata |
36870306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 42260281 - 42260193
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||| ||| ||||||||||||| |
|
|
| T |
42260281 |
cttctgttagtcaatatgacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaataccccctgaatttgaaaatttata |
42260193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1861498 - 1861585
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1861498 |
ttctgttagtaaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatttcccccgaacttgaaaatttata |
1861585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 32860613 - 32860541
Alignment:
| Q |
34 |
atgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32860613 |
atgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32860541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34476789 - 34476702
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
34476789 |
ttctgttagtgaacatgacgttttgcaaatacccccgctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
34476702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 94
Target Start/End: Complemental strand, 35194842 - 35194782
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35194842 |
atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccgaactt |
35194782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 50182005 - 50181918
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
50182005 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttata |
50181918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 18964059 - 18963976
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
18964059 |
ttctgttagtgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaattt |
18963976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 20599434 - 20599359
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20599434 |
aacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20599359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 23590600 - 23590687
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||| |||||||||||||||| ||||||||| | || ||||||||||||||||| |
|
|
| T |
23590600 |
cttctgttagttaacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgtctcctgaacttgaaaatttata |
23590687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 26172390 - 26172315
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
26172390 |
ttctgttagtaaacatgacgttttgcaaataaccccctgaagttttacacttatgtgcaaaatgccccccgaactt |
26172315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30356607 - 30356689
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||| |||| ||||| |||||||||| |
|
|
| T |
30356607 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaat---ccccaaacttaaaaatttata |
30356689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 47309170 - 47309095
Alignment:
| Q |
31 |
aacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47309170 |
aacatgatgttttgcaaatactctcctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
47309095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 56279902 - 56279977
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
56279902 |
aacatgaagttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
56279977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1195686 - 1195600
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| | ||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
1195686 |
ttctgttagtgaacatgacattttgcaaatatccccataaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
1195600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1613570 - 1613656
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
1613570 |
ttctgttagttaacatgaggttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttgaaaatttata |
1613656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 15739659 - 15739578
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| |||||||||| ||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
15739659 |
tgttagtcaacataacattttgcagataccccg-gaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttata |
15739578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22535320 - 22535406
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||| |||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
22535320 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
22535406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22731182 - 22731268
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22731182 |
ttctgttagtgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22731268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 25706053 - 25705987
Alignment:
| Q |
40 |
ttttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
25706053 |
ttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgtctcccgaacttgaaaatttata |
25705987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26476451 - 26476536
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
26476451 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgtaaaatgcccccc-aacttaaaaatttata |
26476536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30288781 - 30288867
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
30288781 |
ttctgttagtgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttata |
30288867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30317683 - 30317769
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
30317683 |
ttctgttagtgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttata |
30317769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 39333502 - 39333584
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||| |||| ||||||| |||||| |||||||||||| |
|
|
| T |
39333502 |
ttctgttagtcaacatgacgttttgcaaatatccccctgaagttttgcagttatgtgcaaaacgccccctaaacttgaaaatt |
39333584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 42259403 - 42259489
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||||||| ||| ||||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
42259403 |
cttctgttaatcaacatgacgttttacaaataccccccgaaattttgcactcatgtgcaaaatgccccatgaacttgaaaatttata |
42259489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 45764633 - 45764707
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
|||||| ||||||||| ||||||| |||||||||||||||||||| |||| ||||| ||||||||| |||||||| |
|
|
| T |
45764633 |
tgttagtcaacatgacgttttgcagataccccctgaagttttgcagttatgtgcaacatgccccccaaacttgaa |
45764707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45895491 - 45895576
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
45895491 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
45895576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 50605184 - 50605110
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| | |||||||||||| || || |||||||||| |
|
|
| T |
50605184 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccctaaatttaaaaatttata |
50605110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 51110767 - 51110681
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| | || || |||||||||| |
|
|
| T |
51110767 |
ttctgttagtaaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaatttaaaaatttata |
51110681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 56443253 - 56443336
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| |||||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
56443253 |
ttctgttagttaacatgatgttttgcaaataccccctcaagttttgtacttatgtgcaaaatg--ccccgaacttgaaaatttata |
56443336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6194870 - 6194785
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||| ||||||| ||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
6194870 |
ttctgttagtgaacatgacgttttgcaaatagcccctaaagtttttcacttatgtgcaaaatgccccacaaacttaaaaatttata |
6194785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 6507618 - 6507682
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| | ||||||||||| |||||||||| |
|
|
| T |
6507618 |
ttttgcaaataccccctgaagttttgcacttatgtgcaaaaag-cccccgaacttaaaaatttata |
6507682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 23520065 - 23519975
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc----tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| || |||||||| ||| ||||||||| |||||| |
|
|
| T |
23520065 |
cttctgttagtcaacatgaaattttgcaaatacccccctcctgaagttttgcacttatgtgtaaaatgcctcccaaacttgaaagtttata |
23519975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26763321 - 26763237
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
26763321 |
ttctgttagtgaacatgacgttttgcaaatacccattgaagttttgcacttatgtgcaaaat-accaccgaacttgaaaatttata |
26763237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 29860053 - 29860141
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| | |||||||||||||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
29860053 |
cttctgttagtcaacatgacgttttgcaaatacatctcctgaagttttgcacttacgtgcaaaatgcatctcgaacttgaaaatttata |
29860141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 96
Target Start/End: Complemental strand, 39334387 - 39334310
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
39334387 |
ttctgttagtcaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatggcccatgaacttga |
39334310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 48799785 - 48799869
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| | ||||||| ||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
48799785 |
ttctgttagtaaacatgacgttttgcaaatacccctt-aagttttacacttatgtacaaaatgcctcccgaacttgaaaatttata |
48799869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 52346250 - 52346175
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
52346250 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt-aaaatttata |
52346175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 1862091 - 1862016
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
1862091 |
aacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
1862016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 9360507 - 9360439
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
9360507 |
cttcttttagtcaacatgacgttttgcaaatacctcctgaagttttacacttatgtgcaaaatgccccc |
9360439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23519444 - 23519533
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc----tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
23519444 |
ttctgttagtcaacatgaagttttgcaaatacccccctcctgaagttttgcacttatgtgcaaaatgcccccaaaatttgaaaatttata |
23519533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 105
Target Start/End: Original strand, 29342580 - 29342652
Alignment:
| Q |
33 |
catgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || |||||| | ||| ||||| |||||||||| |
|
|
| T |
29342580 |
catgacgttttgcaaataccccctgaagttttgcacttatatgtaaaatgtctcccaaacttaaaaatttata |
29342652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 31559867 - 31559792
Alignment:
| Q |
30 |
caacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
31559867 |
caacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaat-acccccgaacttaaaaatttata |
31559792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37687751 - 37687665
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
37687751 |
ttctgttagtcaacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaactttaaaatttata |
37687665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 12213358 - 12213283
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| ||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
12213358 |
aacatcacattttgcaaatacccctatgaagttttgcccttatgtgcaaaatgtcccccgagcttgaaaatttata |
12213283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22535935 - 22535860
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
22535935 |
aacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
22535860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 26477063 - 26476988
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
26477063 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgcgcaaaatgtcccccaaacttaaaaatttata |
26476988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 29245551 - 29245618
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
29245551 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
29245618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 29616852 - 29616919
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
29616852 |
caacatgacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgcccactgaacttgaa |
29616919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 32464929 - 32465003
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||| |||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
32464929 |
aacatcacatttgccaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccgaacttgaaaatttata |
32465003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 34732684 - 34732759
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
34732684 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaagttaaaaatttata |
34732759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 52177344 - 52177267
Alignment:
| Q |
31 |
aacatgacattttgcaaata---ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
52177344 |
aacatggcgttttgcaaataaccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttata |
52177267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 53139939 - 53139864
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||| || |||||||||||| |||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53139939 |
ttctgttagtcaacataacgttttgcaaatactcccttaaagttttgcacttatgtgcaaaatgccccccgaactt |
53139864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 13993889 - 13993943
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13993889 |
ccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13993943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 19170284 - 19170226
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
19170284 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaattta |
19170226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24317747 - 24317832
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24317747 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatg-cccccaaacttaaaaatttata |
24317832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25644777 - 25644863
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||| |||||| ||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
25644777 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaaattttgcgcttatgtgcaaaatgccccccaaacctaaaaatttata |
25644863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 31559156 - 31559218
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatg |
82 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| | ||||||| |
|
|
| T |
31559156 |
ttctgttagtcaacatgacgttttgcaaatatcccctgaagttttgcacttatgttcaaaatg |
31559218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38901476 - 38901562
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||||||||||||||||| ||||||||||| || ||||| |||||||||| |
|
|
| T |
38901476 |
ttctgttagtgaacatgatgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccttccaaacttaaaaatttata |
38901562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 40132479 - 40132425
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40132479 |
ccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40132425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 40220831 - 40220747
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || ||| ||||||||||| |||||||||||||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
40220831 |
cttctgttagtcaacataacgttt-gcaaatacccc-tgaagttttgcacttacgtacaaaatgtcccccgaacttgaaaatttata |
40220747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41789314 - 41789399
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
41789314 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-accccaaacttaaaaatttata |
41789399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42593546 - 42593460
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | || |||||||||||| ||||||||||||||| ||||| ||| |||||| |
|
|
| T |
42593546 |
ttctgttagtgaacatgacgttttgcaaataccccccttaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttata |
42593460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 44097781 - 44097862
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||| |
|
|
| T |
44097781 |
ttctgttagtcaacatgacgtttgacaaataccccctgaagttttgtacttatgtgcaaaatg-cttccgaacttgaaaattt |
44097862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 23 - 86
Target Start/End: Complemental strand, 45765633 - 45765568
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
45765633 |
tgttagtcaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgcccc |
45765568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 47308613 - 47308667
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
47308613 |
ccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
47308667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 47838831 - 47838746
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
47838831 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagtttttcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
47838746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 33 - 105
Target Start/End: Complemental strand, 7862891 - 7862818
Alignment:
| Q |
33 |
catgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
7862891 |
catgacattttacaaatacccccttgaagttttacacttatgtgcaaaatgtcccctaaacttgaaaatttata |
7862818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 17971112 - 17971169
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
17971112 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
17971169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 23475265 - 23475340
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
23475265 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
23475340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 27180537 - 27180461
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
27180537 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttata |
27180461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 33 - 105
Target Start/End: Complemental strand, 29762377 - 29762304
Alignment:
| Q |
33 |
catgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| |||||||| ||||| |||||||||| |
|
|
| T |
29762377 |
catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagatgccccctaaacttaaaaatttata |
29762304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 35194137 - 35194225
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| || |||||||| |||||||||||||| | ||||||||||||||||| |||||||| | ||| ||||||||||||||||| |
|
|
| T |
35194137 |
cttctgtgagtcaacatgatgttttgcaaataccctccttgaagttttgcacttatatgcaaaatactccctgaacttgaaaatttata |
35194225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 48083986 - 48083901
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| ||||||||| ||||||||||||| ||||||||||||||||| | |||||||| || | ||| ||||||||||||| |
|
|
| T |
48083986 |
ttctattagtcaacatgacgttttgcaaatacctcctgaagttttgcacttgtgtgcaaaatacctcatgaatttgaaaatttata |
48083901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 48800378 - 48800302
Alignment:
| Q |
31 |
aacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
48800378 |
aacatgaagttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttata |
48800302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 55082568 - 55082644
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||| || ||||||| ||||||||| |
|
|
| T |
55082568 |
aacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccacctgaacttggaaatttata |
55082644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 55496635 - 55496719
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||| ||||||||| ||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
55496635 |
ttctgttagtaaacatgatgttttgtaaatacccc-tgaagttttacacttatgtgcaaaatgctcctcgaacttgaaaatttata |
55496719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13966822 - 13966909
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| ||||||||||||||| ||| | | |||||||| |
|
|
| T |
13966822 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccaaacataataatttata |
13966909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 23396850 - 23396774
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| || |||||||||| | |||||||| || ||||||||| |
|
|
| T |
23396850 |
cttctgttagtcaacatgacattttgcaaatacccccctaaaattttgcacttgtgtgcaaaataccacccgaactt |
23396774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 26171801 - 26171872
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26171801 |
cttctgttagtgaacatgaagttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgcccccc |
26171872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 34824798 - 34824884
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| || |||||| ||||| ||||| |||||||||| |
|
|
| T |
34824798 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgtaaaatg-cccccaaacttaaaaatttata |
34824884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 37302500 - 37302564
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||||| |||| |||||||||||||| |
|
|
| T |
37302500 |
tgttagtcaacatgatgttttgcaaatagcccctgaagttttgcagttatgtgcaaaatgccccc |
37302564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 42592048 - 42592120
Alignment:
| Q |
34 |
atgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||| ||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
42592048 |
atgacgttttgcaaaaaccccgctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaaatttata |
42592120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 6076909 - 6076996
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||| ||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
6076909 |
cttctgttagtcaacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttata |
6076996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 7390083 - 7389996
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||| ||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
7390083 |
cttctgttagtcaacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttata |
7389996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 29617540 - 29617465
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| |||||||||| |||| |||||||||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
29617540 |
caacatgacgtttttcaaataccccatgaaattttgcacttatgtgcaaaataccccttaaacttgaaaatttata |
29617465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 30289585 - 30289518
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
30289585 |
ttctgttagtgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgccccc |
30289518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 30318488 - 30318421
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
30318488 |
ttctgttagtgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgccccc |
30318421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 50604580 - 50604655
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| | ||||| || |||| ||||| |||||||||| |
|
|
| T |
50604580 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtacaaaacgctccccaaacttaaaaatttata |
50604655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 918524 - 918439
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||| ||||||||||||||||| ||||||||| | ||| ||||| |||||||||| |
|
|
| T |
918524 |
ttctgttagtgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatg-ctcccaaacttaaaaatttata |
918439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4941078 - 4940992
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||| |||||||| || |||||||||||||||| || |||||| ||||||||||| |||||||||| |
|
|
| T |
4941078 |
ttctgttagtgaatatgacgttttgtaaataccctcttgaagttttgcacttatgtgtaaaatgtcccccgaacttaaaaatttata |
4940992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 9024708 - 9024794
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| | ||||||| ||||||||| |||| |||||||||| ||||| |||||||||| |
|
|
| T |
9024708 |
ttctgttagtgaacatgatgttttgcaaataccctcttgaagttatgcacttatgtgcataatgccccccaaacttaaaaatttata |
9024794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13967723 - 13967637
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || || ||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
13967723 |
ttctgttagtgaacatgacgttttgcaaatattcctctaaagttttgcacttatatgcaaaatgtcccccaaacttaaaaatttata |
13967637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32825555 - 32825641
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||| || |||||||||||| |||||||||| || |||| || |||||||||| |
|
|
| T |
32825555 |
ttctgttagtgaacatgacgttttgcaaatatccccctaaaattttgcacttatatgcaaaatgctcctcgaatttaaaaatttata |
32825641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 51110173 - 51110258
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
51110173 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcatttatgtgcaaaatg-cctccaaacttaaaaatttata |
51110258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4940185 - 4940270
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||| || |||||||||||| |||| |||||||||||| || || || |||||||||| |
|
|
| T |
4940185 |
ttctgttagtgaacatgatgttttgcaaatacaccatgaagttttgcaattatgtgcaaaatgccctccaaatttaaaaatttata |
4940270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 7972905 - 7972840
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7972905 |
ttctgttagtgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcc |
7972840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24791615 - 24791700
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| || ||||||||||| ||||||||||||| | || || |||||||||| |
|
|
| T |
24791615 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttata |
24791700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 24816646 - 24816561
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| || ||||||||||| ||||||||||||| | || || |||||||||| |
|
|
| T |
24816646 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttata |
24816561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 25490196 - 25490128
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||| |||| ||| ||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
25490196 |
ttctattagtcaatatgacgttttgcaaatacccccactgaagttttgcacttatgtgcaaaatgcccc |
25490128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 29761505 - 29761580
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
29761505 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatg-tccccaaacttaaaaatttata |
29761580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 105
Target Start/End: Complemental strand, 33617546 - 33617485
Alignment:
| Q |
44 |
gcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||| | |||||| |||||||||| |
|
|
| T |
33617546 |
gcaaataccctctgaagttttgcatttatgtgcaaaatgcccactgaacttaaaaatttata |
33617485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 40146352 - 40146295
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
40146352 |
aacatgaaattttgcaaatacccccctgaagtttttcacttatgtgcaaaatgccccc |
40146295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 55778216 - 55778131
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||| | |||||||||||||| |||| || ||||||||| ||||||||| | || ||||||||||||||||| |
|
|
| T |
55778216 |
ttctgttagtcaagatggcgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttata |
55778131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 55842396 - 55842311
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||| | |||||||||||||| |||| || ||||||||| ||||||||| | || ||||||||||||||||| |
|
|
| T |
55842396 |
ttctgttagtcaagatggcgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttata |
55842311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 105
Target Start/End: Complemental strand, 56444184 - 56444104
Alignment:
| Q |
25 |
ttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||||| || |||||||||||||||| ||||||||||||||||| ||||||||| || | |||||||||||||||| |
|
|
| T |
56444184 |
ttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cctctaaacttgaaaatttata |
56444104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 1618589 - 1618506
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||| |||| |||||||| ||||| ||||| ||||||||| |
|
|
| T |
1618589 |
ttctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcgcttacgtgcaaaatatcccccaaacttaaaaatttat |
1618506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 57 - 105
Target Start/End: Complemental strand, 32465518 - 32465470
Alignment:
| Q |
57 |
gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32465518 |
gaagttttgaacttataagcaaaatgccccccgaacttgaaaatttata |
32465470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 38035736 - 38035676
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
38035736 |
caaataccccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaaatttata |
38035676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 42987999 - 42987939
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42987999 |
caaataccctctgaaattttgcacttatgtgcaaaatgccccgtaaacttgaaaatttata |
42987939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 24 - 105
Target Start/End: Original strand, 4630653 - 4630736
Alignment:
| Q |
24 |
gttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccg-aacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||| ||||||||||||||| ||||||||||||| |||| |||||||||||| | | || ||||||||||||| |
|
|
| T |
4630653 |
gttagtcaacatgatgttttgcaaatacccctctgaagttttgcatttatgtgcaaaatgccctctgaaatttgaaaatttata |
4630736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 15030947 - 15031006
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaa |
78 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
15030947 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaa |
15031006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21312162 - 21312078
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| || ||||| |||||||| |||||||||||| |
|
|
| T |
21312162 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgtaaaat--accccgaacatgaaaatttata |
21312078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 38350463 - 38350531
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| ||||||||| | ||| |||||||||||||| |
|
|
| T |
38350463 |
aacatgacgttttgcaaataccccct----ttttgcacttatgtgcaaaatgtctcccaaacttgaaaattta |
38350531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 38902087 - 38902016
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||||||| || ||||| ||||| ||||| |||||||||| |
|
|
| T |
38902087 |
atgacgttttgcaaatatcccctgaaattttgcacttatgtggcaaatgtcccccaaacttaaaaatttata |
38902016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 23395951 - 23396036
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| || |||||| |||||||| || | | |||||||||||||||| | ||||||| | |||||||||||||||||||| |
|
|
| T |
23395951 |
cttctgttagtcagcatgacgttttgcaa-tatctcttgaagttttgcacttacgtacaaaatgtctcccgaacttgaaaatttata |
23396036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 30779078 - 30779132
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
30779078 |
ccccctgaagttttgcacttaagtgcaaaatgccccctcaacttgaaattttata |
30779132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 36076690 - 36076744
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
36076690 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
36076744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 38392183 - 38392237
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
38392183 |
ccccctgaaattttgcacttatgtgcaaaatggcccctaaacttgaaaatttata |
38392237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 40278401 - 40278455
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
40278401 |
ccccctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttata |
40278455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 41904672 - 41904618
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
41904672 |
ccccctggaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
41904618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 100
Target Start/End: Complemental strand, 19538421 - 19538372
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaat |
100 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
19538421 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaat |
19538372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 56473754 - 56473717
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgca |
67 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
56473754 |
caacatgacgttttgcaaataccccctgaagttttgca |
56473717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 10663728 - 10663656
Alignment:
| Q |
34 |
atgacattttgcaaataccccctga-agttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||||| | ||||||| |||||| ||||||||||| ||||||||| ||| |||||| |
|
|
| T |
10663728 |
atgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttata |
10663656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 10877873 - 10877801
Alignment:
| Q |
34 |
atgacattttgcaaataccccctga-agttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||||| | ||||||| |||||| ||||||||||| ||||||||| ||| |||||| |
|
|
| T |
10877873 |
atgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttata |
10877801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 36077214 - 36077162
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
36077214 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
36077162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 36928400 - 36928348
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
36928400 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
36928348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 40279217 - 40279165
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
40279217 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
40279165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 41610663 - 41610746
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||| | ||||||||||| ||||||||| |||| ||||||| ||||||||| ||||| ||||| |||||||| |
|
|
| T |
41610663 |
ttctgttagtcaacataaagttttgcaaatacccccctgaaatttttcacttatgtgcaaaatgtcccccaaactt-aaaattta |
41610746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 220775 - 220721
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| ||| ||||||||||| ||||| |
|
|
| T |
220775 |
ccccctgaaattttgcacttatgtgcaaaatgtcccttgaacttgaaaaattata |
220721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 36927575 - 36927629
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
36927575 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaatttgaaaatttata |
36927629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 38393015 - 38392957
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| || ||||||| ||| ||||| |||||||| |
|
|
| T |
38393015 |
caaataccccctgaaattttgcacttatgtgaaaaatgctccctaaacttaaaaattta |
38392957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 39633526 - 39633472
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
39633526 |
ccccccgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttata |
39633472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 40034309 - 40034255
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
40034309 |
ccccctaaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttata |
40034255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 42341855 - 42341909
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| ||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
42341855 |
ccccctgaaattttacacttatgtgcaaaataccccctaaacttgaaaatttata |
42341909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 43419724 - 43419786
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||||| |||| |||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
43419724 |
ttttacaaatactccctaaagttttgcactta-ttgcaaaatg--ccccgaactttaaaatttata |
43419786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 105
Target Start/End: Complemental strand, 54284030 - 54283980
Alignment:
| Q |
55 |
ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
54284030 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
54283980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 7972020 - 7972081
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaa |
80 |
Q |
| |
|
||||||||| |||||||| ||||| ||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
7972020 |
ttctgttagtgaacatgacgttttgtaaacaccgccctgaagttttgcacttatgtgcaaaa |
7972081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 105
Target Start/End: Complemental strand, 22525257 - 22525228
Alignment:
| Q |
76 |
caaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22525257 |
caaaatgccccccgaacttgaaaatttata |
22525228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 104
Target Start/End: Complemental strand, 1565884 - 1565832
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
1565884 |
cccctggaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat |
1565832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 6450250 - 6450286
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6450250 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
6450286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 29797355 - 29797391
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc |
55 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
29797355 |
cttctgttagtcagcatgacattttgcaaataccccc |
29797391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 34016952 - 34017004
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
34016952 |
ccccctgaaattttgcacttatgtgcaaaatgctccctaaacttaaaaattta |
34017004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 40033482 - 40033518
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
40033482 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
40033518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 205)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41411921 - 41412006
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41411921 |
ttctgttagcgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 6915413 - 6915331
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
6915413 |
cttctgttagccaacatgacgttttgcaaataacccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatt |
6915331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1830151 - 1830066
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1830151 |
ttctgttagcgaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1830066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8407507 - 8407592
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8407507 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8407592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40315618 - 40315533
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40315618 |
ttctgttagcgaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40315533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6680616 - 6680701
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6680616 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6680701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29373968 - 29373883
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29373968 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29373883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38395507 - 38395592
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38395507 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38395592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 12404319 - 12404236
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
12404319 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta |
12404236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 23 - 98
Target Start/End: Original strand, 38977687 - 38977762
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
38977687 |
tgttagtcaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaa |
38977762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 25338866 - 25338792
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25338866 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25338792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1829526 - 1829611
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
1829526 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
1829611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6809465 - 6809377
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
6809465 |
cttctgttagtcaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttata |
6809377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11445185 - 11445270
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
11445185 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttata |
11445270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 32 - 105
Target Start/End: Complemental strand, 16869210 - 16869137
Alignment:
| Q |
32 |
acatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16869210 |
acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
16869137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 25823718 - 25823633
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||| | |||||||||| |
|
|
| T |
25823718 |
ttctgttagcgaacatgacgctttgcaaataccccctgaagttttgcacttatgtgcaaaatgcgccccgaacctaaaaatttata |
25823633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32273110 - 32273025
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32273110 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
32273025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40314993 - 40315078
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
40314993 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
40315078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1144366 - 1144279
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1144366 |
ttctgttagtaaacatgacgttttgcaaatatcccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
1144279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 96
Target Start/End: Complemental strand, 11157993 - 11157917
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
11157993 |
ttctgttagtcaacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttga |
11157917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 38424941 - 38424854
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
38424941 |
cttctgttagtcaacatgatgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttata |
38424854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 459595 - 459681
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
459595 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
459681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 2061335 - 2061249
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
2061335 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
2061249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3307280 - 3307194
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
3307280 |
ttctattagtcaacataacattttgcaaatatgcccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttata |
3307194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 3508176 - 3508262
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3508176 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3508262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3508803 - 3508717
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3508803 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3508717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4152549 - 4152635
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4152549 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
4152635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 5577357 - 5577271
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||| |||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
5577357 |
ttctgttagtcaacatgacgttttgcaaatactcccctgaacttttgcacttatgtgcaaaatgccccctgaacatgaaaatttata |
5577271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7482359 - 7482445
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7482359 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7482445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8160061 - 8160147
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8160061 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8160147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8160685 - 8160599
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8160685 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8160599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12737028 - 12736942
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12737028 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12736942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 12799225 - 12799311
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12799225 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12799311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12799851 - 12799765
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12799851 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12799765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13307079 - 13306993
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13307079 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13306993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16048505 - 16048591
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16048505 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
16048591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17526809 - 17526723
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
17526809 |
ttctgttagtgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttata |
17526723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17647409 - 17647495
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
17647409 |
ttctgttagttaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
17647495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 19289244 - 19289330
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
19289244 |
ttctgttagtgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttata |
19289330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26395514 - 26395600
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26395514 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26395600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 27188712 - 27188627
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| || |||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27188712 |
cttctgttagtcaacatgatgttttgcaaatatcctctgaagttttgcacttatgtgcaaaatgc-ccccgaacttgaaaatttata |
27188627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38483672 - 38483586
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38483672 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38483586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40195972 - 40195886
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40195972 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40195886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42437880 - 42437966
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
42437880 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
42437966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4843787 - 4843872
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4843787 |
ttctgttagtgaacatgacgttttgcaaatacctcctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttata |
4843872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38465225 - 38465310
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
38465225 |
ttctgttagtgaacatgacgttttgcaaatacccactgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
38465310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41085319 - 41085234
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| ||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
41085319 |
ttctgttagtaaacatgatgttttgcaaataccccctgaagttttacacttatgtacaaaatgccccccaaacttgaaaatttata |
41085234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41209619 - 41209703
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41209619 |
ttctgttagtaaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaat-acccccgaacttgaaaatttata |
41209703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41412546 - 41412461
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| ||||| |
|
|
| T |
41412546 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaaattata |
41412461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6845067 - 6845154
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6845067 |
ttctgttagtgaacatgacgttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6845154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 9772356 - 9772443
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9772356 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9772443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11445812 - 11445725
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11445812 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11445725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 25482598 - 25482511
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25482598 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25482511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38978405 - 38978318
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
38978405 |
ttctgttagttaacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttata |
38978318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 460227 - 460141
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
460227 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
460141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 5576481 - 5576552
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
5576481 |
caacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
5576552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 12403696 - 12403771
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12403696 |
aacatgacgttttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12403771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 16353041 - 16353112
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
16353041 |
atgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaactaaaaaatttata |
16353112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22613569 - 22613494
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22613569 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22613494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 2060707 - 2060793
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
2060707 |
ttctgttagtgaacatgacgtttttcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
2060793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4844413 - 4844327
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
4844413 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
4844327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4912542 - 4912456
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4912542 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
4912456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6166630 - 6166544
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
6166630 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
6166544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6835356 - 6835270
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||| ||||||||||||||||| ||||||||||||| |||| || |||||||||| |
|
|
| T |
6835356 |
cttctgttagtcaacatgatgttttgaaaataccccttgaagttttgcacttatgtgcaaaatgcccctcgaatttaaaaatttata |
6835270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7482976 - 7482890
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7482976 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7482890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8505990 - 8505904
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| |||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
8505990 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccctctgaacttgaaaatttata |
8505904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9475928 - 9475842
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9475928 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
9475842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 12366625 - 12366699
Alignment:
| Q |
32 |
acatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12366625 |
acatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12366699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12367239 - 12367153
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12367239 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttata |
12367153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 12736401 - 12736487
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12736401 |
ttctgttagtgaacatgacgttttgcaaataccccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13306458 - 13306544
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13306458 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
13306544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13545399 - 13545311
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac---cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| | |||||| |||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
13545399 |
ttctgttagtctacatgatgttttgcaaatacacccccctgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatttata |
13545311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16868579 - 16868665
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16868579 |
ttctgttagtgaagatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
16868665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17526182 - 17526268
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17526182 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17526268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25481970 - 25482056
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||||||| |||||| ||||| |||||||||| |
|
|
| T |
25481970 |
ttctgttagtgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttata |
25482056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32272485 - 32272571
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
32272485 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
32272571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 36778327 - 36778401
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| ||||||||| ||| | |||||||||||||||| |
|
|
| T |
36778327 |
aacatgacgttttgcaaataccccctgaatttttgcacttatatgcaaaatgtccctcaaacttgaaaatttata |
36778401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36810935 - 36811021
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36810935 |
ttctgttagtgaacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36811021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39760694 - 39760780
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
39760694 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
39760780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39761322 - 39761236
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39761322 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39761236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4104944 - 4104859
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||| |||||| || ||||| |||||||||| |
|
|
| T |
4104944 |
ttctgttagtgaacatgacgttttacaaataccccctgaagttttgcacttatctgcaagatgccctccaaacttaaaaatttata |
4104859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4153174 - 4153090
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
4153174 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
4153090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8408136 - 8408052
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||||| ||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8408136 |
ttctgttagtgaacatgacgttt-gcaaataccccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttata |
8408052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 24 - 105
Target Start/End: Complemental strand, 14197970 - 14197889
Alignment:
| Q |
24 |
gttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||| ||||| ||||||||| ||| ||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
14197970 |
gttagtcaacatgacgttttgtaaataccccatgatgttttgcacttatatgcaaaatgccccttgaacttgaaaatttata |
14197889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 19292353 - 19292434
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||| ||||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
19292353 |
ttctattagtcaacatgacgttttgcaaataccccccgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
19292434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 19293214 - 19293129
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| | | ||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
19293214 |
ttctgttagtcaacatgacgttttgcaaatacctcattaagttttgcacttatgtgcaaaatatcccctgaacttgaaaatttata |
19293129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36779179 - 36779094
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| || ||||||||| || ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36779179 |
ttctgttagtgaacatgacgttttgcaaataccccctaaaattttgcactgatgtgcaaaatgccccccaaacttaaaaatttata |
36779094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4104050 - 4104136
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
4104050 |
ttctgttagcgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
4104136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 4911914 - 4912001
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
4911914 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
4912001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6845696 - 6845609
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
6845696 |
ttctgttagagaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
6845609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7951462 - 7951376
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| ||||||||| |||| |||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
7951462 |
ttctattagtcaacatgacgttttccaaatacctcccctgaagttttgcacttatgtgcaaaatgc-ccccgaacttgaaaatttata |
7951376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17085927 - 17086014
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17085927 |
ttctgttagtgaacttgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17086014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21632408 - 21632321
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21632408 |
ttctgttagtgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21632321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21640655 - 21640568
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21640655 |
ttctgttagtgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21640568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38465819 - 38465732
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
38465819 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
38465732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40195353 - 40195440
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
40195353 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
40195440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 20730997 - 20731068
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
20730997 |
atgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccttgcacttgaaaatttata |
20731068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 5575026 - 5574940
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||| ||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5575026 |
ttctgttagtcaacataacgtttggcaaatacccccttgaagttttgcacttatatgcaaaatgccccataaacttgaaaatttata |
5574940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 9475305 - 9475390
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
9475305 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
9475390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9772983 - 9772897
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||| |||||||||| |||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9772983 |
ttctgttagagaacatgacgttttgcaaacaccctcctgaagtttggcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9772897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17648349 - 17648263
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| |||||| ||||||||||| || |||||| |||||||||| |
|
|
| T |
17648349 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttaaaaatttata |
17648263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18146421 - 18146336
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
18146421 |
ttctgttagtgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
18146336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26359841 - 26359755
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| ||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
26359841 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtactcatgtgcaaaatgccccatgaacttgaaaatttata |
26359755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 98
Target Start/End: Complemental strand, 27341992 - 27341915
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27341992 |
tgttagtcaacatgatgttttgcaaatatcccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaa |
27341915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36811547 - 36811461
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
36811547 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatttcccccaaacttaaaaatttata |
36811461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39406184 - 39406270
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||| |||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
39406184 |
ttctgttagtgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
39406270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 1143779 - 1143855
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1143779 |
aacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1143855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18145798 - 18145882
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||| ||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18145798 |
ttctgttagtgaacatgtcgttttgcaaataccccc-gaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
18145882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 19289861 - 19289785
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| ||| |||||| |
|
|
| T |
19289861 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaactttata |
19289785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 26396141 - 26396065
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26396141 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaactt |
26396065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 41210207 - 41210131
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41210207 |
aacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41210131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5574087 - 5574174
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5574087 |
ttctgttagttaacatgacgttttgcaaatactccccctgaagttttttacttatgtgcaaaatgccccttgaacttgaaaatttata |
5574174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 86
Target Start/End: Complemental strand, 5790495 - 5790431
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
5790495 |
tgttagtcaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
5790431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 11277475 - 11277399
Alignment:
| Q |
30 |
caacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||||| ||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
11277475 |
caacatcacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttata |
11277399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 27257145 - 27257209
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
27257145 |
ttctgttagtaaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgcc |
27257209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 27341291 - 27341371
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
|||||| |||||| || ||||||||||| ||||| |||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
27341291 |
tgttagtcaacatcacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccctccgaacttaaaaattt |
27341371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38396128 - 38396041
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| || ||||||||| || ||||| |||||||||| |
|
|
| T |
38396128 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgaaaaatgccctccaaacttaaaaatttata |
38396041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42341252 - 42341339
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||| ||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
42341252 |
ttctgttagtgaacataacgttttacaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
42341339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 9587645 - 9587720
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||| |||||||||| | |||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
9587645 |
aacatgacgttttgtaaatacccccctaaagttttgcatttatatgcaaaatgccccctgaacttgaaaatttata |
9587720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 34216982 - 34217065
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||| ||||||||||||| | ||||||||||||||| || |||||||||||| | ||||||||||||||||| |
|
|
| T |
34216982 |
tgttagtcaacatgatgttttgcaaataccgctctgaagttttgcactcatgtgcaaaatgccctctgaacttgaaaatttata |
34217065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6865353 - 6865267
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| |||||||||||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
6865353 |
ttctgttagtaaacatgacgttttgcaaatacgcccttgaagttttgcacttatgtgcaaaatgccctctaaacttaaaaatttata |
6865267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 21 - 86
Target Start/End: Original strand, 15180577 - 15180643
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
15180577 |
tctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
15180643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21640036 - 21640122
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||| |||||||||||||||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
21640036 |
ttctgttagtgaacaagacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgttccccgaacttaaaaatttata |
21640122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 88
Target Start/End: Original strand, 25338260 - 25338318
Alignment:
| Q |
31 |
aacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25338260 |
aacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccccc |
25338318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 29373343 - 29373428
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
29373343 |
ttctgttagtaaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
29373428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 36086249 - 36086168
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||| || |||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
36086249 |
ttctattagtcaacatgacgttttgcaaataccccccaaaattttgcacttatgtgcaaaatg-cccctgaacttgaaaattt |
36086168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38144019 - 38143933
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||| |||||||||| ||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38144019 |
ttctgttagtgaacatgacgttttgcaaatatccccatgaagttttgagcttatgtgcaaaatgccccccaaacttaaaaatttata |
38143933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38186553 - 38186639
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
38186553 |
ttctgttagtgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
38186639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38211804 - 38211718
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
38211804 |
ttctgttagtgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
38211718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 56 - 105
Target Start/End: Original strand, 14196030 - 14196079
Alignment:
| Q |
56 |
tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
14196030 |
tgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttata |
14196079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 21085867 - 21085932
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | | ||||||||||||||||| |||||||||| |
|
|
| T |
21085867 |
cttctgttagtcaacatgacattttgcaaatactctcttgaagttttgcacttatgtgcaaaatgc |
21085932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 4299674 - 4299606
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4299674 |
ttctgttagtgaacatgacgttttgcaaatatccacctgaagttttgcacttatgtgcaaaatgccccc |
4299606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 24361707 - 24361635
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||| ||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
24361707 |
aacatgacgttttgcaaatacccccctgaaattttacacttatgtgcaaaatgccccccaaacttaaaaattt |
24361635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 105
Target Start/End: Original strand, 29235607 - 29235663
Alignment:
| Q |
49 |
taccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
29235607 |
taccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
29235663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 25455672 - 25455759
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| | |||||||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25455672 |
cttctgttagtcaacatgatgttttgcaaatacccctcaaaagttttgtacttatgtgcaaaatgccattcgaacttgaaaatttata |
25455759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 26244091 - 26244009
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
26244091 |
cttctgttagtcaacatcatgttttgcaaatacccctctgaagtcttgcacttatgtgcaaaat-acccccgaacttgaaaatt |
26244009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 26359265 - 26359348
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||||| |||||||||||||| |||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
26359265 |
tgttagtcaacataacgttttgcaaataccctcctgaagttttgcatttatgtgcaaaatgtcccctaaacttaaaaatttata |
26359348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 32293756 - 32293830
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
32293756 |
aacaagacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatg-cccccgaacttaaaaatttata |
32293830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 42546308 - 42546371
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaat |
81 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
42546308 |
cttctgttagtcaacatgacattttacaaatacctccatgaagttttgcacttatgtgcaaaat |
42546371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 105
Target Start/End: Original strand, 43067665 - 43067716
Alignment:
| Q |
54 |
cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43067665 |
cctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43067716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 970529 - 970614
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || | ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
970529 |
ttctgttagtgaacatgacgttttgcaaatatcctcatgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
970614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 4000006 - 4000064
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
4000006 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
4000064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 6166019 - 6166091
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| ||||||||| | ||| ||||| |||||||||| |
|
|
| T |
6166019 |
aacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatg-ctcccaaacttaaaaatttata |
6166091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 6808455 - 6808540
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||| |||| ||||||| |||||||||| ||| ||||| ||| |||||| |
|
|
| T |
6808455 |
cttctgttagtcaacatgacgttttgcaaata-cccctgaaattttccacttatgtgcaaaatgcttcccaaacttaaaagtttata |
6808540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 6914250 - 6914335
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| | ||| ||||||||| ||||| ||||||||| | | ||||||||||||||||| |
|
|
| T |
6914250 |
cttctgttagtcaacatgacgttttgcaaata-ctcctaaagttttgcgcttatgtgcaaaatgtctcttgaacttgaaaatttata |
6914335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 10622889 - 10622947
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
10622889 |
caaataccccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaattta |
10622947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 10623442 - 10623388
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10623442 |
ccccctgaaattttgcacttatatgcaaaatgccccctaaacttgaaaatttata |
10623388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 10818318 - 10818256
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaat |
81 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||| |||| ||||||| |||||||| |
|
|
| T |
10818318 |
ttctgttagtcaacatgacattttgcaaataccccactgaaattttacacttatgtgcaaaat |
10818256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 15181171 - 15181117
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15181171 |
ccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
15181117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 16362857 - 16362799
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaa |
78 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
16362857 |
ttctgttagtgaacatgacgttttgcaaatacctcctgaagttttgcacttatgtgcaa |
16362799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 26242900 - 26242985
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||| |||||| || |||||||| ||||| ||||||||||||||| || || |||||| ||||||||||| |||||||||| |
|
|
| T |
26242900 |
cttccgttagtcaacatcacgttttgcaattaccctctgaagttttgcactaatgtggaaaatg-cccccgaacttaaaaatttata |
26242985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 746489 - 746550
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
746489 |
caaatacccccatgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
746550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 2301388 - 2301300
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||| | | ||||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2301388 |
cttctgttagtcaacatgacgttttacaaatacatcacatgaagttttacacttatgtgcaaaatgcccctttaacttgaaaatttata |
2301300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 6681232 - 6681157
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
6681232 |
aacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
6681157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 27188052 - 27188105
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttat |
72 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
27188052 |
cttctgttagtcaacatgaggttttgcaaataccccctaaagttttgcacttat |
27188105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 27500872 - 27500819
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27500872 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
27500819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 51 - 96
Target Start/End: Original strand, 30971362 - 30971407
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
30971362 |
ccccctgaagttttgcacttatgtgcgaaatgccccccgaacttga |
30971407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 105
Target Start/End: Complemental strand, 42341856 - 42341792
Alignment:
| Q |
41 |
tttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
42341856 |
tttgcaaatacccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
42341792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42438541 - 42438457
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||| |||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
42438541 |
ttctgttagtgaacatgacgttttgcaaatacctt-tgaaattttgcacttatgtgcaaaatgctccccaaacttaaaaatttata |
42438457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6834606 - 6834693
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||| |||| ||||||| ||||||||| || |||||| |||||||||| |
|
|
| T |
6834606 |
ttctgttagtcaacatgactttttgcaaataccacccctgaaattttacacttatgtgcaaaatgtccattgaacttaaaaatttata |
6834693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 11157071 - 11157154
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| |||||||||||||||||||| || |||||||| ||| |||| ||||||| |
|
|
| T |
11157071 |
ttctgttaatcaacatgaagttttgcaaatacctcccctgaagttttgcacttatgtggaaaatgcctcccaaactcgaaaatt |
11157154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 105
Target Start/End: Complemental strand, 13968764 - 13968708
Alignment:
| Q |
49 |
taccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
13968764 |
taccccctgaaattttgcacttatgtgcaaattgccccctaaacttgaaaatttata |
13968708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 17587992 - 17587921
Alignment:
| Q |
20 |
ttctgttagccaacatgacatttt-gcaaataccccct--gaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
17587992 |
ttctgttagtgaacatgacgtttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgcccccc |
17587921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 33 - 84
Target Start/End: Original strand, 21360655 - 21360707
Alignment:
| Q |
33 |
catgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
21360655 |
catgaccttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc |
21360707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 24325082 - 24325010
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||| |||| || ||||||||||||||| ||||| ||||||| |
|
|
| T |
24325082 |
aacatgacgttttgcaaatacccccctgaaattttacactaatgtgcaaaatgccccccaaacttaaaaattt |
24325010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 25525920 - 25525872
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
25525920 |
ccccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaa |
25525872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 99
Target Start/End: Complemental strand, 32294638 - 32294557
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc---ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||| |||| ||||||||| |||| ||||||||||| |
|
|
| T |
32294638 |
ttctgttagtgaacatgacgttttgcaaatacccctccctgaagttttgcagttatgtgcaaaatg-cccctgaacttgaaaa |
32294557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 41084742 - 41084790
Alignment:
| Q |
40 |
ttttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41084742 |
ttttgcaaataccaccctgaagttttgcacttatgtgcaaaatgccccc |
41084790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 6864457 - 6864524
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
6864457 |
ttctgttagtgaacatgacgttttgcaaatactttctgaagttttgtacttatgtgcaaaatgccccc |
6864524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 7978571 - 7978642
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||| ||||||||| || || ||||| |||||| |
|
|
| T |
7978571 |
aacatgacattttgcaaatatctccatgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatt |
7978642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 13544681 - 13544767
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||| ||||| ||| |||| |||||||||||| ||| |||||| |
|
|
| T |
13544681 |
cttctgttaatcaacatgatgttttgcaaatacccccttgaagttttgc-cttatgtgcgaaataccccccgaacttaaaagtttata |
13544767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 24324479 - 24324553
Alignment:
| Q |
31 |
aacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24324479 |
aacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatg-cccccaaacttaaaaatttata |
24324553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 24361103 - 24361177
Alignment:
| Q |
31 |
aacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24361103 |
aacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatg-cccccaaacttaaaaatttata |
24361177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 4001070 - 4001020
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
4001070 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt |
4001020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7950911 - 7950998
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc---ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| ||||||||| ||| ||||||||| ||||||||||||||||| || |||||||| |||| ||||||||||||||||| |
|
|
| T |
7950911 |
ttcttttagtcaacatgacgttt-gcaaataccttcccctgaagttttgcactaatgtgcaaaataccccttgaacttgaaaatttata |
7950998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 11276706 - 11276760
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
11276706 |
ccccctgaaattttgcacttatgtgcaaaataccctccgaatttgaaaatttata |
11276760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 11665076 - 11665160
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| || ||||| |||||| |||||||| || |||||||| |||||||||| |
|
|
| T |
11665076 |
cttctgttaatcaacatgacattttgc-aataccccctaaaattttgtacttatgtgcaaaat-acctccgaacttaaaaatttata |
11665160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 25751862 - 25751916
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
25751862 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttata |
25751916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 80
Target Start/End: Complemental strand, 36089819 - 36089761
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaa |
80 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
36089819 |
tgttagtcaacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaa |
36089761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Original strand, 36498621 - 36498671
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
36498621 |
ccccctgaaattttgcacttatgtgcaaaatgccccacaaacttgaaaatt |
36498671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 40988844 - 40988784
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
40988844 |
caaatacccccatgaaattttgcacttatgtgcaaaatgc-ccccaaacttgaaaatttata |
40988784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 26662170 - 26662238
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| | ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
26662170 |
cttctgttagtcaacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc |
26662238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 26933765 - 26933833
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| | ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
26933765 |
cttctgttagtcaacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc |
26933833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 29835512 - 29835564
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
29835512 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
29835564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 36499170 - 36499118
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
36499170 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
36499118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 105
Target Start/End: Original strand, 39047466 - 39047510
Alignment:
| Q |
61 |
ttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
39047466 |
ttttgcacttatctgcaaaatgccccctcaacttgaaaatttata |
39047510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 102
Target Start/End: Complemental strand, 24087448 - 24087389
Alignment:
| Q |
43 |
tgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||||||||| | | |||||||||||||| |
|
|
| T |
24087448 |
tgcaaataccccctgaagttttgtatttatgtgcaaaatgtcacatgaacttgaaaattt |
24087389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 2745450 - 2745396
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
2745450 |
ccccctgaaattttgcacttatgtgcaaaacgccccttaaacttgaaaatttata |
2745396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 16868212 - 16868170
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
16868212 |
caaataccccctgaaattttgctcttatgtgcaaaatgccccc |
16868170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 21086226 - 21086152
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| ||||||||||| || || ||||||||||||||| |||||||||| | |||||||||||| |||| |
|
|
| T |
21086226 |
aacacgacgttttgcaaatatcctcttaagttttgcacttatgtgcaaaatgcgcattgaacttgaaaatatata |
21086152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 21362477 - 21362401
Alignment:
| Q |
30 |
caacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| |||| | |||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
21362477 |
caacatgacgttttgcgaatagctcccctgaagttttt-acttatgtgcaaaatgcccctagaacttgaaaatttata |
21362401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 25456694 - 25456640
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||| |||||| || |||||||||| |
|
|
| T |
25456694 |
ccccttgaagttttgaacttatgtgcaaaatgccgcccgaatttaaaaatttata |
25456640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 26394848 - 26394794
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26394848 |
ccccctgaaattttacacttatgtgcaaaatgccccataaacttgaaaatttata |
26394794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 38090483 - 38090537
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
38090483 |
ccccctgaaattttgcacttatgtgcaaaatgtcccataaacttgaaaatttata |
38090537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 729487 - 729539
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
729487 |
ccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaattta |
729539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 97
Target Start/End: Original strand, 3306550 - 3306629
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| ||||||||||||| |||| |||||||| |||| ||||||||| |
|
|
| T |
3306550 |
ttctgttagttaacatgatgttttacaaataccccccctgaagttttgcatttatgtgcaaaataccccttgaacttgaa |
3306629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 5382346 - 5382294
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
5382346 |
ccccctgaaattttgcaattatgtgcaaaatgccccctaaacttaaaaattta |
5382294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 9673240 - 9673188
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| || |||||| |||||||| |
|
|
| T |
9673240 |
ccccctaaagttttgcacttatgtgcaaaatgcgtcctgaacttaaaaattta |
9673188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 17587359 - 17587423
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||| ||||| ||||||| |||| |||||||||| |
|
|
| T |
17587359 |
ttctgttagtgaacaagacgttttgcaaatacccctctgaaattttgcatttatgtgcaaaatgc |
17587423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 25752892 - 25752840
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
25752892 |
ccccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaattta |
25752840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 33159802 - 33159750
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||| ||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
33159802 |
cccccagaatttttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
33159750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 37895996 - 37895932
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| |||||| || |||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
37895996 |
ttctgttagtcaacataacgttttgcaaatacattcatgaagttttgcacttatgtgcaaaatgc |
37895932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 38091355 - 38091303
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
38091355 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
38091303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 39048413 - 39048377
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39048413 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
39048377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 40988059 - 40988111
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
40988059 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
40988111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 8e-30; HSPs: 176)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 25630300 - 25630386
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
25630300 |
cttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttata |
25630386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37747142 - 37747057
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
37747142 |
ttctgttagtcaacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttata |
37747057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 7723864 - 7723790
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7723864 |
aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7723790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 15730623 - 15730689
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15730623 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
15730689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 14244392 - 14244477
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
14244392 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
14244477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 29119213 - 29119298
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29119213 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29119298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 33880625 - 33880540
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
33880625 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgctcttatgtgcaaaatgccccccaaacttaaaaatttata |
33880540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 21 - 105
Target Start/End: Original strand, 5690530 - 5690614
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
5690530 |
tctgttagacaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccttccgaacttaaaaatttata |
5690614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 41450423 - 41450340
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
41450423 |
cttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg---cccgaacttgaaaatttata |
41450340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 3416794 - 3416876
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
3416794 |
tgttagtcaacatcacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgttccccgaacttgaaaatttata |
3416876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 9737106 - 9737032
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9737106 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9737032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 14450093 - 14450179
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
14450093 |
ttctgttagtgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
14450179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 14450709 - 14450635
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
14450709 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
14450635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17925222 - 17925136
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17925222 |
ttctgttagtaaacatgacgttttgcaaatacgcccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
17925136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40450551 - 40450465
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40450551 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
40450465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 44308242 - 44308316
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44308242 |
aacatgacattttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccttgaacttgaaaatttata |
44308316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36508479 - 36508394
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36508479 |
ttctgttagtgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36508394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 38714785 - 38714697
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| |||| |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
38714785 |
cttctgttagtcaacatgacgttttgcaaataccccccctgaaattttgcacttatgtgcaaaatgcctcccgaacttgaaaatttata |
38714697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43924299 - 43924214
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43924299 |
ttctgttagtgaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43924214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 17733894 - 17733827
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
17733894 |
cttctgttagccaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc |
17733827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 25631232 - 25631145
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| | ||| |||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25631232 |
cttctgttagtcaacatgaaattttgcaaataccccgttgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
25631145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 36255649 - 36255562
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| | |||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
36255649 |
cttctgttagtcaacatgacgttttgcaaatatcgccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaattttata |
36255562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 355925 - 355839
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
355925 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
355839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 1587986 - 1588060
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
1587986 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
1588060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 2656939 - 2657025
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
2656939 |
ttctgttagtgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccagacttaaaaatttata |
2657025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 7723262 - 7723336
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
7723262 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
7723336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 10443184 - 10443270
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
10443184 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
10443270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 14053938 - 14053852
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
14053938 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
14053852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 15731482 - 15731568
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15731482 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
15731568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 15732110 - 15732024
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15732110 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
15732024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18809695 - 18809781
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18809695 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
18809781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21559794 - 21559708
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21559794 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21559708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24573397 - 24573483
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
24573397 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
24573483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32989886 - 32989800
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32989886 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32989800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36468979 - 36469065
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36468979 |
ttctgttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaactttaaaatttata |
36469065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36893886 - 36893972
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36893886 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36893972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36894513 - 36894427
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36894513 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36894427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38713489 - 38713574
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
38713489 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccgaacttgaaaatttata |
38713574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40520281 - 40520367
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40520281 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40520367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 40520909 - 40520835
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40520909 |
aacatgacgttttgcaaataccacctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40520835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41258057 - 41257971
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41258057 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41257971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43084945 - 43085031
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43084945 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43085031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43284343 - 43284429
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43284343 |
ttctgttagtgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43284429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1077313 - 1077397
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
1077313 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
1077397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5219897 - 5219982
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||||||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
5219897 |
ttctgttagtgagcatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
5219982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 5220464 - 5220399
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5220464 |
ttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
5220399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5794707 - 5794792
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||||||||| | ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5794707 |
ttctgttagtgaacatgacgttttgcaaataccacctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttata |
5794792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9116217 - 9116132
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
9116217 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatatgcaaaataccccccaaacttaaaaatttata |
9116132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 15602042 - 15601955
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15602042 |
cttctgttagtcaacatgacgttttgcaaataccctacctgaagttttgcacttatgtgcaaaatgcccccc-aacttaaaaatttata |
15601955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29119841 - 29119756
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
29119841 |
ttctgttagggaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
29119756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17961082 - 17960995
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17961082 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17960995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43433026 - 43433113
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43433026 |
ttctgttagtgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43433113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 1650485 - 1650559
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1650485 |
aacaagacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1650559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1651047 - 1650961
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
1651047 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttata |
1650961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3927724 - 3927638
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
3927724 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
3927638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 10825420 - 10825506
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
10825420 |
ttctgttagtgaacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
10825506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11856138 - 11856224
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11856138 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaaattttgcacttatatgcaaaatgccccccaaacttaaaaatttata |
11856224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 14053324 - 14053398
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
14053324 |
aacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttata |
14053398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 15211515 - 15211429
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
15211515 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
15211429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21558886 - 21558972
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
21558886 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
21558972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38713873 - 38713960
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc---ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
38713873 |
ttctgttagtgaacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatg-cccccgaacttgaaaatttata |
38713960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39132859 - 39132945
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||| | ||| |||||||||| |
|
|
| T |
39132859 |
ttctgttagtgaacatgacattttgcaaatacccctccgaagttttgcacttatgtgcaaaatgccccccaatcttaaaaatttata |
39132945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39407188 - 39407274
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39407188 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39407274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43923402 - 43923488
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43923402 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
43923488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 23564002 - 23564090
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23564002 |
cttctgttagtcaacatcacgttttgcaaatatcctccctgaagttttgcacttcagtgcaaaatgccccccgaacttgaaaatttata |
23564090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 103
Target Start/End: Original strand, 23564794 - 23564867
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| || ||||| ||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
23564794 |
caacatcacgttttgtaaatacctcctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaaattta |
23564867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23916021 - 23916105
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
23916021 |
ttctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
23916105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39407813 - 39407729
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
39407813 |
ttctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
39407729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39863473 - 39863557
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||||||||||| ||||||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
39863473 |
ttctgttagtcaacataacgttttgcaaataccccctgaagtttcgcactta-gtgcaaaatgcctcccgaactttaaaatttata |
39863557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 105
Target Start/End: Original strand, 41450053 - 41450138
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||| ||||||||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
41450053 |
tctgttagtcatgatgacgttttgcaaatacccccatgaagttttgcacttatgtacaaaatgccctccgaacttgaaaatttata |
41450138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43433652 - 43433568
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43433652 |
ttctgttagtgaacatgacgttttgcaaatatccc-tgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43433568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 99
Target Start/End: Complemental strand, 13002138 - 13002058
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
13002138 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaa |
13002058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 14245019 - 14244932
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
14245019 |
ttctgttagtgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
14244932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 27072595 - 27072508
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| | ||||||| ||||||||||||||| |||||| |
|
|
| T |
27072595 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgttcaaaatgtcccccgaacttgaaattttata |
27072508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 33851577 - 33851656
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||| ||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33851577 |
cttctattagccaacatcacattttgaaaataccctccctaaagttttgcacttatgtgcaaaatgccccccgaacttga |
33851656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 33872764 - 33872696
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
33872764 |
ttctgttagagaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgcccccc |
33872696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39324585 - 39324672
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
39324585 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
39324672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 3454769 - 3454844
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3454769 |
aacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
3454844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6653904 - 6653817
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||| ||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
6653904 |
cttctgttaatcaacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttata |
6653817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6734304 - 6734217
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||| ||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
6734304 |
cttctgttaatcaacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttata |
6734217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 11179959 - 11179896
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11179959 |
ttctgttagtgaacatgatattttgcaaataccccctgaagttttgcacttatgtgcaaaatgc |
11179896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 20166666 - 20166591
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20166666 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20166591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 25094257 - 25094340
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
25094257 |
tgttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
25094340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 37429544 - 37429469
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37429544 |
aacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37429469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 2657554 - 2657480
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || ||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
2657554 |
aacataacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
2657480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 5691478 - 5691392
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || ||||| |||||||||||||||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
5691478 |
cttctgttagtcaacatcacgttttgtaaataccccctgaagttttgcacttacatgcaaaatgccgctgaaacttgaaaatttata |
5691392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 5795333 - 5795247
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||| |||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
5795333 |
ttctgttagtgaacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttata |
5795247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 7482784 - 7482698
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| | || |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
7482784 |
cttctgttaatcaacatgacgttttgcaaataccccataaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
7482698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 94
Target Start/End: Original strand, 11178856 - 11178921
Alignment:
| Q |
31 |
aacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11178856 |
aacatgacgttttgcaaatacatcccctgaagttttgcacttatgtgcaaaatgccccccgaactt |
11178921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 15207568 - 15207654
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
15207568 |
ttctgttagtgaacatgacgttttgcaaatacttccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
15207654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17960454 - 17960540
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||| ||||| ||||| ||| |||||| |
|
|
| T |
17960454 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaagtttata |
17960540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 20166074 - 20166162
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata---ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
20166074 |
ttctgttagtaaacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttata |
20166162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 29100751 - 29100836
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
29100751 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
29100836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29101233 - 29101147
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | ||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
29101233 |
ttctgttagtgaacatgacgttttgcaaatactcacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
29101147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 31127626 - 31127560
Alignment:
| Q |
40 |
ttttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31127626 |
ttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
31127560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 97
Target Start/End: Original strand, 31819841 - 31819919
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31819841 |
ttctgttagtcaacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgccccttgaacttgaa |
31819919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 33871865 - 33871951
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
33871865 |
ttctgttagtgaacatgacgttttgcaaataaaccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
33871951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 26884 - 26800
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||| |||||||||||||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
26884 |
tgttagtcaacataacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttgaaaatttata |
26800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 10307827 - 10307912
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| |||||||||||| || ||||| ||||||||| |
|
|
| T |
10307827 |
ttctgttagtgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttat |
10307912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 35942747 - 35942671
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
35942747 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
35942671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 355310 - 355386
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||| |||||| ||||| |||||||||| |
|
|
| T |
355310 |
aacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttata |
355386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 3177933 - 3177993
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
3177933 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
3177993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11650873 - 11650960
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
11650873 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttata |
11650960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11651435 - 11651344
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc------tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11651435 |
ttctgttagtgaacatgacgttttgcaaataccccccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11651344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 12764236 - 12764296
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12764236 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
12764296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36740093 - 36740006
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccc--cccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| |||||||||||||| ||||||||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
36740093 |
ttctgttagtgaatatgacgttttgcaaataccctatgaagttttgcacttatatgcaaaatgcccctcccgaacttaaaaatttata |
36740006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43085713 - 43085626
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
43085713 |
ttctgttagtgaacatgatattttacaaatacctcccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
43085626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 9114802 - 9114877
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
9114802 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttata |
9114877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 12503150 - 12503063
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| | ||||||||| |||||||||||| |||| |||||||||||||||| || ||||||| || ||||||||||||||||| |
|
|
| T |
12503150 |
cttctgttggtcaacatgacgttttgcaaatacacccttgaagttttgcacttatgtgtaaaatgcatcctgaacttgaaaatttata |
12503063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 28776754 - 28776684
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
28776754 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccc |
28776684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39133257 - 39133170
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccc-cccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
39133257 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccctgccaaacttaaaaatttata |
39133170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 41257441 - 41257516
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
41257441 |
aacatgacggtttgcaaatacccccctgaagttttgcacttatgtgcaaaatggcccccaaacttaaaaatttata |
41257516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25942 - 26028
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| | ||| |||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25942 |
ttctgttagttaacatgacgttttacaaatactctcctaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
26028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3419018 - 3418931
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc---ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| || ||||||||||||||||| | ||||||| ||||||||||| |||||||||| |
|
|
| T |
3419018 |
ttctgttagtcaacatgacgttttgcaaatacccctccatgaagttttgcacttatgtccaaaatg-cccccgaacttaaaaatttata |
3418931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 9736233 - 9736318
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| |||||||| || || |||||||| |
|
|
| T |
9736233 |
ttctgttagagaacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcaaactgccccccaaatttaaaaattta |
9736318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13001513 - 13001598
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| | |||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
13001513 |
ttctgttagtgaacatgacgttttgcaaataccccgttgaagttttgcacttatatgcaaaatg-cccccaaacttaaaaatttata |
13001598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 15565587 - 15565501
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| |||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
15565587 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctcaacttaaaaatttata |
15565501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 17924636 - 17924710
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
17924636 |
aacatgaagttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
17924710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31820551 - 31820465
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | ||||||||||||||| |||||||||| ||||||| ||||||||| |||| |||||| |||||||||| |
|
|
| T |
31820551 |
ttctgttagtcaacataaagttttgcaaatacccctctgaagttttccacttatgtgcaaaatgtcccctgaactttaaaatttata |
31820465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32989260 - 32989346
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| ||| |||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32989260 |
ttctgttagtgaacatgacgttttgtaaacacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32989346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 1077925 - 1077868
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
1077925 |
aacatgacattttgcaaatacccgtctgaagttttgcacttatgtgcaaaatgccccc |
1077868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 10831302 - 10831237
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
10831302 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc |
10831237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 20832772 - 20832687
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||| |||||||||||||| |||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
20832772 |
ttctgttagttaacataacgttttgcaaatatcccctgaagttttgtacttatgtgcaaaataccccataaacttgaaaatttata |
20832687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26430655 - 26430739
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||| | ||||||| ||||| ||||| |||||||||| |
|
|
| T |
26430655 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttaagtacaaaatg-cccccaaacttaaaaatttata |
26430739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 31917941 - 31918017
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
31917941 |
aacatgacgttttgcaaataccccccctgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttata |
31918017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 33852946 - 33852859
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||| ||||||| ||||||||||||||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
33852946 |
cttctgttattcaacatcacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatg-ccaccgaacttgaaaatttata |
33852859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 39864170 - 39864105
Alignment:
| Q |
33 |
catgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
39864170 |
catgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaa |
39864105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 44444944 - 44445020
Alignment:
| Q |
31 |
aacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| ||||||||||||| |||||||||||| ||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
44444944 |
aacacgacgttttgcaaatacctcccctgaagttttacacttatgtacaaaatgccccccgaatttgaaaatttata |
44445020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 10308576 - 10308490
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
10308576 |
ttctgttagtgaatatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
10308490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 15564647 - 15564711
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
15564647 |
ttctgttagtcaacataacgttttgcaaataccccccgaagttttgcacttatgagcaaaatgcc |
15564711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26431551 - 26431464
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| || |||||| ||| | ||||| |||||||||| |
|
|
| T |
26431551 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgtaaaatgtcccacaaacttaaaaatttata |
26431464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 35772485 - 35772417
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
35772485 |
ttctgttagtgaacatgacattttgcaaataccgcccttaagttttgcacttatgtgcaaaatgtcccc |
35772417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 3925996 - 3926059
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatg |
82 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
3925996 |
ttctgttagtgaacatgacgttttgcaaataccccgctgaagttttgcacttatgtgcaaaatg |
3926059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 33872969 - 33873043
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
33872969 |
aacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
33873043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 37428668 - 37428742
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
37428668 |
aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaat-ccccccaaacttaaaaatttata |
37428742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 44629058 - 44629141
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| |||||||||||||||| | ||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
44629058 |
tgttagtcaacatctcattttgcaaataccctcatgaagttttgcacttatgtgcataatgccattcgaacttgaaaatttata |
44629141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17732973 - 17733059
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | ||| |||||||| |||||| |||||||| |||| ||||| |||||||||| |
|
|
| T |
17732973 |
ttctgttagtcaacatgacattttgcaaatactcacctaaagttttgtacttatgtgcaaaataccccttaaacttaaaaatttata |
17733059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 27071713 - 27071787
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || |||||||||||||||||||| || ||||||||| | ||||||||||| |||||| |||||||||| |
|
|
| T |
27071713 |
aacataacgttttgcaaataccccctgaaattgtgcacttatgttcaaaatgccccttgaacttaaaaatttata |
27071787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 47 - 105
Target Start/End: Original strand, 35942157 - 35942215
Alignment:
| Q |
47 |
aataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
35942157 |
aatacctcctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
35942215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39325177 - 39325098
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39325177 |
ttctgttagtgaacatgacgttttgcaaata------gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39325098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 9879219 - 9879143
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| || |||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
9879219 |
aacatgacgttttgcaaatacctcccatgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
9879143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 12383210 - 12383286
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| | ||||||| | ||| ||||| |||||||||| |
|
|
| T |
12383210 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgttcaaaatgactcccaaacttaaaaatttata |
12383286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 36573640 - 36573552
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| || ||||||||||||||||||| |||||||||| || ||||| |||||||||| |
|
|
| T |
36573640 |
cttctgttagttaacatgacgttttgcaaataacctccctgaagttttgcacttatgtgcaaaatgctcctttaacttaaaaatttata |
36573552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 40449951 - 40450039
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||||| |||| ||||| |
|
|
| T |
40449951 |
cttctgttagtgaatatgaagttttgcaaataccccccctgaagttgtgcacttatgtgcaaaatgccccccaaacttaaaaacttata |
40450039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 23 - 98
Target Start/End: Complemental strand, 27575987 - 27575911
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||| |||||||||| ||||||| ||||||||| || | |||||||||| |
|
|
| T |
27575987 |
tgttagtcaatatgacgttttgcaaatacccctctgaagttttacacttatgtgcaaaatgtcctctgaacttgaaa |
27575911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 105
Target Start/End: Original strand, 28776146 - 28776209
Alignment:
| Q |
42 |
ttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
28776146 |
ttgcaaatacccctctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
28776209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 29732729 - 29732646
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||| |||| ||||||| |||||||| || | ||||||||||||||||| |
|
|
| T |
29732729 |
tctgttagtgaacatgacgttttgcaaataccccttgaaattttacacttatatgcaaaat-acctctgaacttgaaaatttata |
29732646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 44671968 - 44671916
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
44671968 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaattta |
44671916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 15633356 - 15633267
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc---ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| ||||| ||||||||| ||||| |||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15633356 |
cttctgttagtcaatatgacgttttgtaaatacccctccctgaaattttatacttatgtgcaaaatgcccccccaacttaaaaatttata |
15633267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 32449079 - 32449160
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| | ||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
32449079 |
tgttagtcaacatgacgttttgcaaataccatataaagttttgcacttatgtgcaaaatg-cctccaaacttaaaaatttata |
32449160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 35771643 - 35771716
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || ||||||||||| ||| |||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
35771643 |
aacataacgttttgcaaatatcccatgaaattttgcacttatgtgcaaaatg-ccccgaaacttgaaaatttata |
35771716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36507876 - 36507961
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| ||| ||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
36507876 |
ttctgttagtgaacatgacgttttacaaatacccccctgaggttttgcacttatgtgcaaaat-acccccaaacttaaaaatttata |
36507961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 97
Target Start/End: Original strand, 37746422 - 37746500
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| | || ||||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
37746422 |
ttctgttaatcaacatgacgttttgcaaatatctccatgaagttttgcacttatgtgcaaaatgtcccttgaacttgaa |
37746500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 41392688 - 41392742
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
41392688 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttata |
41392742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 41543207 - 41543153
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
41543207 |
ccccctgaaattttgcacttatgtgcagaatgccccctaaacttgaaaatttata |
41543153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 42356196 - 42356154
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
42356196 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccc |
42356154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 42994490 - 42994436
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
42994490 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttata |
42994436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 6870051 - 6869990
Alignment:
| Q |
22 |
ctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatg |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||| |||||| ||||||||| |
|
|
| T |
6870051 |
ctgttagccaacatgacattttgcaaatatccccttaaagtttttgacttatgtgcaaaatg |
6869990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 30729073 - 30729012
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
30729073 |
caaatacccccatgaaattttgcacttatgtgcaaaatgcccactaaacttgaaaatttata |
30729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 31918533 - 31918469
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
31918533 |
ttttgcaaataacccctgaagttttacacttatgtgcaaaatg-cctccaaacttaaaaatttata |
31918469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 43284931 - 43284866
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
43284931 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgca--tatgtgcaaaatgcccc |
43284866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 44868532 - 44868584
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
44868532 |
ccccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaattta |
44868584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 12502228 - 12502282
Alignment:
| Q |
30 |
caacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatg |
82 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
12502228 |
caacatgacgttttgcaaatacccaccctgaagttttgcatttatgtgcaaaatg |
12502282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 12765033 - 12764982
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
12765033 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
12764982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 38256558 - 38256613
Alignment:
| Q |
50 |
accccctgaagttttgcacttatttgcaaaatgccccccgaa-cttgaaaatttat |
104 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
38256558 |
accccctgaaattttgcacttatgtgcaaaatgcccccctaattttgaaaatttat |
38256613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 4488797 - 4488743
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||| || ||||||||||||| |
|
|
| T |
4488797 |
ccccctgaaattttgcacttatgtgcaaaacgccccctaaatttgaaaatttata |
4488743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 31204029 - 31204082
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
31204029 |
ccccctgaaattttgcacttatgtgcaaaatg-cccctaaacttgaaaatttata |
31204082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 31204588 - 31204528
Alignment:
| Q |
45 |
caaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
31204588 |
caaataccccctctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
31204528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 41575089 - 41575130
Alignment:
| Q |
64 |
tgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
41575089 |
tgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
41575130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 44445539 - 44445450
Alignment:
| Q |
18 |
acttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| || ||||||| |||||||||| | ||||||||||||| ||||||| ||||||||| |||| | ||||| |||||||||| |
|
|
| T |
44445539 |
acttctgtcagtgaacatgaagttttgcaaatgctcccctgaagttttacacttatgtgcaaaatgtccccgcaaacttaaaaatttata |
44445450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 1143952 - 1143916
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
1143952 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
1143916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 3178486 - 3178434
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
3178486 |
ccccctgaaattttgcacttatctgcaaaatgccccttaaacttaaaaattta |
3178434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 4484688 - 4484740
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
4484688 |
ccccctgaaattttgcacttaagtgcaaaatgccccctaaacttaaaaattta |
4484740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36251941 - 36252028
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||||| | ||||||||||| ||||||| |||||||||||| ||||||||| | || ||||| |||||||||| |
|
|
| T |
36251941 |
ttcttttagtcaacatgatgtattgcaaatacctcccctgaaattttgcacttatgtgcaaaatgtctcctaaacttaaaaatttata |
36252028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 37262456 - 37262404
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| ||||| |||||||| |
|
|
| T |
37262456 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaattta |
37262404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 41576689 - 41576637
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
41576689 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
41576637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 191)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41081013 - 41080928
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41081013 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41080928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29418110 - 29418023
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29418110 |
ttctgttagtcaacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
29418023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30838539 - 30838624
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30838539 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30838624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39628500 - 39628585
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39628500 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39628585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39628937 - 39628852
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39628937 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39628852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 35499323 - 35499240
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35499323 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttacacttatttgcaaaatgccccccgaacttgaaaattt |
35499240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 18829186 - 18829272
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
18829186 |
cttctgttagtcaacatcacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatatata |
18829272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23678851 - 23678765
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23678851 |
ttctgttagtcaacatcacgttttacaaatacctccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
23678765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 44335283 - 44335357
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44335283 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44335357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 3628074 - 3628147
Alignment:
| Q |
32 |
acatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3628074 |
acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3628147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21124937 - 21125022
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21124937 |
ttctgttagtcaacataatgttttgcaaataccccctgaaattttgcacttatctgcaaaatgccccccgaactttaaaatttata |
21125022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21176086 - 21176171
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
21176086 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttata |
21176171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34959129 - 34959044
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||||| ||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
34959129 |
ttctgttagtcaacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccctgaacttgaaaatttata |
34959044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40246082 - 40245997
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40246082 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40245997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43670716 - 43670800
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43670716 |
ttctgttagtgaacatgacattttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43670800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43775533 - 43775449
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
43775533 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
43775449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 46949645 - 46949561
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
46949645 |
ttctgttagtcaacatgacgttttgcaaatacccccggaagttttgcacttatgtgcaaaatgc-ccccaaacttgaaaatttata |
46949561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11455543 - 11455630
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11455543 |
ttctgttagagaacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11455630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22113994 - 22114081
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22113994 |
ttctgttagtgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
22114081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40525447 - 40525360
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40525447 |
ttctgttagtgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
40525360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 48610751 - 48610838
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
48610751 |
ttctgttagtcaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcaacccgaacttgaaaatttata |
48610838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 4287053 - 4287140
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| || || ||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
4287053 |
cttctgttagtcaatatcacgttttgcaaatacccccctgaagttttgcacttatgtgctaaatgccccccgaacttgaaaatttata |
4287140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 33697319 - 33697232
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
33697319 |
cttccgttagtcaacatgatgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
33697232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 48936283 - 48936366
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
48936283 |
tgttagtcaacatgacgttttgcagatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
48936366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 4288330 - 4288244
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||||||||||||| |||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
4288330 |
cttctgttagtcaacatcatgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgcctcccgaaattgaaaatttata |
4288244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17271908 - 17271994
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
17271908 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
17271994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18031701 - 18031615
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18031701 |
ttctgttagcgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
18031615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 26928208 - 26928282
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26928208 |
aacatgatgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
26928282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 28290133 - 28290219
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
28290133 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
28290219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 31309373 - 31309291
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| | ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
31309373 |
tgttagtcaacatcatgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
31309291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 33228554 - 33228468
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
33228554 |
ttctgttaatcaacatgaaattttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccgaacttgaatatttata |
33228468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 35500585 - 35500499
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
35500585 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
35500499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36644158 - 36644244
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36644158 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36644244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40668050 - 40668136
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40668050 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40668136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44335898 - 44335812
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44335898 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44335812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 44744384 - 44744470
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44744384 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44744470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44745012 - 44744926
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44745012 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44744926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21176709 - 21176624
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
21176709 |
ttctgttagtgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
21176624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39403531 - 39403447
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39403531 |
ttctgttagtgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39403447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 46100877 - 46100792
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
46100877 |
tctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
46100792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 46230200 - 46230116
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
46230200 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
46230116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7337906 - 7337819
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7337906 |
ttctgttagtgaacatgacgttttgcaaatacccaccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7337819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17774413 - 17774500
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
17774413 |
ttctgttagtcaatatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaaattgaaaatttata |
17774500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 30 - 105
Target Start/End: Original strand, 24212440 - 24212516
Alignment:
| Q |
30 |
caacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
24212440 |
caacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaacatgaaaatttata |
24212516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34994664 - 34994577
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
34994664 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
34994577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 40524706 - 40524782
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttga |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| ||||||| |
|
|
| T |
40524706 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgcacttgtgtgcaaaatgtcccccaaacttga |
40524782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45155035 - 45155122
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
45155035 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
45155122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 45155664 - 45155577
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
45155664 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
45155577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 45259625 - 45259538
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
45259625 |
ttctgttagtaaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttcaaaatttata |
45259538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 5198352 - 5198439
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| | ||||||||||||||||||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
5198352 |
cttctgttagtcaacatgacattttgtaaatattctcctgaagttttgcacttatgtgcaaaatgccacccgaacttaaaaatttata |
5198439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 30023229 - 30023142
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||| || || ||||| |||||||||| |
|
|
| T |
30023229 |
cttctgttagccaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttata |
30023142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 43774661 - 43774736
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
43774661 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
43774736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 5211209 - 5211124
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||||||||||||||| ||||||||| | ||| ||||| |||||||||| |
|
|
| T |
5211209 |
cttctgttagtcaacatgatattttacaaataccccctgaagttttgcacttatgtgcaaaatg-ctcccaaacttaaaaatttata |
5211124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 10463957 - 10463871
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| ||| |||||| |
|
|
| T |
10463957 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaagtttata |
10463871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17272535 - 17272449
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
17272535 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
17272449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18928209 - 18928295
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
18928209 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttttaaatttata |
18928295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 21459478 - 21459393
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
21459478 |
cttctgttagtcaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgccccataaatttgaaaatttata |
21459393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22022956 - 22022882
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| | |||||||| |||||||||||| |
|
|
| T |
22022956 |
aacatgacattttgcaaatacctcctgaagttttgcacttataggcaaaatacaccccgaacatgaaaatttata |
22022882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26303409 - 26303495
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26303409 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26303495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26831653 - 26831739
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26831653 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttata |
26831739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26832598 - 26832512
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt-gaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||| ||||||||||||||||||||||||||||| ||||||||||||||| || || ||||||||||| |
|
|
| T |
26832598 |
ttctgttagtcaacataacgtttggcaaataccccctgaagttttgcacttatgtgcaaaatgcccccctaaattggaaaatttata |
26832512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 29417248 - 29417330
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| ||||||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
29417248 |
ttctgttagtcaacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
29417330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34963120 - 34963034
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
34963120 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
34963034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 34993767 - 34993853
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
34993767 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
34993853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37007810 - 37007724
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
37007810 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
37007724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38171647 - 38171561
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
38171647 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
38171561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38354096 - 38354182
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
38354096 |
ttctgttagtgaacatgacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
38354182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 39402919 - 39402992
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
39402919 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcccc-aacttaaaaatttata |
39402992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 42029192 - 42029119
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
42029192 |
aacatgacgttttgcaaataccccctgaagttt-gcacttatgtgcaaaatgccccccaaacttaaaaatttata |
42029119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 47170941 - 47170855
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
47170941 |
ttctgttagtgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
47170855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18830208 - 18830124
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||| | |||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
18830208 |
ttctgttagtcaacatgacgttttcctaataccccctgaagttttgcacttataagcaaaatgc-ccccgaacttaaaaatttata |
18830124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35004315 - 35004399
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
35004315 |
ttctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttata |
35004399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35788281 - 35788365
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
35788281 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaat-acccccaaacttaaaaatttata |
35788365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36897516 - 36897601
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| | |||| ||||||||||| || |||||||||||||||| |
|
|
| T |
36897516 |
ttctgttagttaacatgacgttttgcaaataccccctgaagttttgtatttatgtgcaaaatgcctccttaacttgaaaatttata |
36897601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37231404 - 37231319
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||| | |||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37231404 |
ttctgttagtgaacatgacgttttgcaaacatcccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37231319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 105
Target Start/End: Complemental strand, 38354710 - 38354637
Alignment:
| Q |
33 |
catgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38354710 |
catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38354637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 94
Target Start/End: Complemental strand, 48611257 - 48611188
Alignment:
| Q |
25 |
ttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
48611257 |
ttagtcaacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccctgaactt |
48611188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7462930 - 7462843
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7462930 |
ttctgttagtgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7462843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 21125653 - 21125574
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
21125653 |
ttctgttagtcaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaa |
21125574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38171026 - 38171113
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38171026 |
ttctgttagtgaagatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38171113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 6804889 - 6804814
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6804889 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
6804814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 14102944 - 14103027
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||| |||||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
14102944 |
tgttagtcaacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttata |
14103027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 14412961 - 14413044
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||| |||||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
14412961 |
tgttagtcaacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttata |
14413044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 44388374 - 44388299
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44388374 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44388299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7337289 - 7337375
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
7337289 |
ttctgttagtgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
7337375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8641024 - 8641110
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
8641024 |
ttctgttagtgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
8641110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8641650 - 8641565
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
8641650 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
8641565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18121433 - 18121348
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
18121433 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
18121348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 26342722 - 26342796
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||||||| |||||||||||| || ||||| |
|
|
| T |
26342722 |
ttctgttagtgaacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaatgccctccaaactt |
26342796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29644976 - 29644890
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||| ||||||||||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
29644976 |
ttctgttagtcaacatgatgttttgcaaatacccccctgaggttttgcacttatgtgcaaaatgccccatgaacttgaaaatatata |
29644890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36787390 - 36787304
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||| ||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
36787390 |
ttctgttagtgaacatgacgttttgcaaatatccccctaaagttttgcacttatgcgcaaaatgccccccaaacttaaaaatttata |
36787304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 41408998 - 41409072
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaact |
93 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
41408998 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaact |
41409072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 44378916 - 44379004
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata---ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
44378916 |
ttctgttagtaaacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttata |
44379004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 44387783 - 44387871
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata---ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
44387783 |
ttctgttagtaaacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttata |
44387871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44781939 - 44781853
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |||||||| |||| | ||||| |||||||||| |
|
|
| T |
44781939 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttata |
44781853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 46100251 - 46100337
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
46100251 |
ttctgttagtgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
46100337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8124952 - 8124867
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || |||||| |||||||||||||||||||| |||||||||||| | ||||||| || | |||||||||||||||| |
|
|
| T |
8124952 |
ttctgttagtcatcatgacgttttgcaaataccccctgaaattttgcacttatatacaaaatgttcctcaaacttgaaaatttata |
8124867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 45 - 98
Target Start/End: Original strand, 9494951 - 9495004
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9494951 |
caaataccccctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaa |
9495004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 30162534 - 30162622
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| | || ||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
30162534 |
cttctgttagtcaacatgacgttttgcaaacatcctccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30162622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 33227812 - 33227877
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
33227812 |
ttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccgttgaacttgaaaatttata |
33227877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 35004937 - 35004854
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
35004937 |
ttctgttagtgaacatgacattttgcaaatacccc-tgaagttttgcacttatgtgcaaaat-tcccccaaacttaaaaatttata |
35004854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36786765 - 36786849
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
36786765 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaat-acccccaaacttaaaaatttata |
36786849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 43759614 - 43759698
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||| |||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
43759614 |
tgttagtcaacataacgttttccaaataccccctctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
43759698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6804001 - 6804088
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||| ||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6804001 |
ttctgttagtgaacatgatgttttgcaagtactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6804088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 34345372 - 34345432
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
34345372 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
34345432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41409566 - 41409479
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
41409566 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacataaaaatttata |
41409479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 1493750 - 1493703
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1493750 |
ttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccc |
1493703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 17897168 - 17897243
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||| | ||| |||||||||| |
|
|
| T |
17897168 |
aacatgacgttttgcaaatacccttctgaagttttgcacttatgtgcaaaatgccccccaagcttaaaaatttata |
17897243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 18031083 - 18031158
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18031083 |
aacatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
18031158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 23379146 - 23379079
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
23379146 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
23379079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 31308365 - 31308447
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||| || || |||||||||||||| ||||||||||||||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
31308365 |
tgttagtcaatatcacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatg-cccctgaacttgaaaatttata |
31308447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 33696615 - 33696698
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||| || |||||||| || |||| |||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33696615 |
tgttagtcaacatgatgttctgcaaataacctcctggagttttgcacttatgtgcaaaatgctccccgaacttgaaaatttata |
33696698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 34962510 - 34962584
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
34962510 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
34962584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 36709388 - 36709455
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36709388 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc |
36709455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 19488707 - 19488792
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
19488707 |
ttctgttagtgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
19488792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 21458731 - 21458817
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||| || |||||||||||| | ||||||||||| || ||||||||||||| |
|
|
| T |
21458731 |
cttctgttagtcaacatgacgttttgcaaatatcccctaaaattttgcacttatgtacaaaatgccccttaaatttgaaaatttata |
21458817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24182000 - 24182086
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||| ||||||||||| ||||| |||| ||||| |
|
|
| T |
24182000 |
ttctgttagtgaacatgacgttttgcaaatacccccccgaagttttgcacttatgtgccaaatgccccccaaacttaaaaaattata |
24182086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24466425 - 24466511
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaa-atgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||||| || ||||| ||||| |||||||||| |
|
|
| T |
24466425 |
ttctgttagtgaacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaatataacccccaaacttaaaaatttata |
24466511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 24646847 - 24646781
Alignment:
| Q |
40 |
ttttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
24646847 |
ttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttata |
24646781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 30890337 - 30890423
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||| ||||||| ||||||||| ||| || ||||| |||||||||| |
|
|
| T |
30890337 |
ttctgttagtgaacatgacgttttgcaaataccccctcaagttttacacttatgtgcaaaatgtccctccaaacttaaaaatttata |
30890423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 36900734 - 36900649
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttg--caaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||||||| ||||||||||||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
36900734 |
tgttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgtgcaaaatgccccctaaacttgaaaatttata |
36900649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40245187 - 40245273
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || ||||||||||| ||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
40245187 |
ttctgttagagaacatgacgttttgcaaatatcctcctgaagttttacacttatgtgcaaaatgtcccccaaacttaaaaatttata |
40245273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41080388 - 41080473
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | |||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41080388 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgca-ttatgtgcaaaatgccccccaaacttaaaaatttata |
41080473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42028577 - 42028663
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||| |||||||||||||||||| || |||||||||||| ||||| ||| |||||| |
|
|
| T |
42028577 |
ttctgttagtgaacatgacgtattgcaaatacccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaattttata |
42028663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 42260804 - 42260890
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| ||||| ||||||||||| || |||||||||||| |||||||||| || ||| ||||||||||||| |
|
|
| T |
42260804 |
cttctgttagtcaatatgacgttttgtaaataccccctaaaattttgcacttatatgcaaaatgctccatgaatttgaaaatttata |
42260890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43082380 - 43082465
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
43082380 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatg-tccccaaacttaaaaatttata |
43082465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 43671598 - 43671532
Alignment:
| Q |
40 |
ttttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
43671598 |
ttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttata |
43671532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 24182618 - 24182542
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||| ||||| |
|
|
| T |
24182618 |
aacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaaattata |
24182542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 40668655 - 40668591
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
40668655 |
ttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
40668591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3628688 - 3628601
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| |||||||| ||||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
3628688 |
ttctgttagtgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttata |
3628601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 15753290 - 15753207
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||||||| ||||||||| | |||||| |||| |||||| ||||||||| |
|
|
| T |
15753290 |
ttctgttagtcaacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttat |
15753207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 22 - 105
Target Start/End: Original strand, 22992090 - 22992173
Alignment:
| Q |
22 |
ctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||| || |||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
22992090 |
ctgttagtcaacatgacgttttgcaaatacccccctaaaattttgcacttatgtgcaaaat-tcctccgaacttgaaaatttata |
22992173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 48343718 - 48343778
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
48343718 |
caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
48343778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 40341179 - 40341109
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
40341179 |
ttctgttagtgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaagtgcccccc |
40341109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 44472790 - 44472715
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |||| ||||||| | |||| |||||||||||||||| |
|
|
| T |
44472790 |
aacatgatattttgcaaatacccctctgaagttttgcatttatgtgcaaaaagttccccaaacttgaaaatttata |
44472715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 30163479 - 30163393
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||| ||| ||| |||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
30163479 |
cttctgttagtcaacatgaaattttgtaaatattccccgaaattttgcacttatgtgcaaaataccccctaaacttaaaaatttata |
30163393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 88
Target Start/End: Original strand, 35498756 - 35498814
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
35498756 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccc |
35498814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41642232 - 41642146
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||| ||| |||||||||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
41642232 |
ttctgttagtgaacataacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttata |
41642146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45856911 - 45856997
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| || ||||||||||||| |||||||| ||| || ||||| |||||||||| |
|
|
| T |
45856911 |
ttctgttagtgaacatgatgttttgcaaatacccccttaaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttata |
45856997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 19072138 - 19072077
Alignment:
| Q |
45 |
caaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
19072138 |
caaatacctccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
19072077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 21366392 - 21366453
Alignment:
| Q |
45 |
caaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
21366392 |
caaataccccactgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
21366453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 24213354 - 24213266
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||| |||| || |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24213354 |
cttctgttaatcaatatgacgttttgcaaatacctcccctcaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttata |
24213266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 26931425 - 26931497
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
26931425 |
aacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatg---cccgaacttaaaaatttata |
26931497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 38184331 - 38184384
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
38184331 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
38184384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 44950682 - 44950629
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
44950682 |
aacatgacgttttgcaaatatcccctgaagttttgcagttatgtgcaaaatgcc |
44950629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 46229568 - 46229660
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttat------ttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
46229568 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagtgcaaaatgccccccaaacttaaaaatttata |
46229660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 15752345 - 15752433
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||| |||||| || ||||||||||||| |||||| || ||| ||||||||||||||||| |
|
|
| T |
15752345 |
cttctgttagtcaacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttata |
15752433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 27316298 - 27316366
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||| |||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
27316298 |
cttctattagtcaacatgacgttttgcaaatacccccctcaagttttgcacttatgtgcaacatgcccc |
27316366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 34345907 - 34345847
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
34345907 |
caaataccccctaaaattttgcacttatgtgcaaaatgtcccctcaacttgaaaatttata |
34345847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 2755987 - 2755912
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||| | ||||| ||| ||||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
2755987 |
aacatgacgttttacgaatactcccatgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttata |
2755912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 7462037 - 7462109
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||||||||| | ||||||||||||| | ||||| |||||||||| |
|
|
| T |
7462037 |
aacatgacgtttcgcaaataccctctgaagttttgcact--tgtgcaaaatgcccctcaaacttcaaaatttata |
7462109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 12231269 - 12231324
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgcccccc-gaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
12231269 |
ccccctgaaattttgcacttatgtgcaaaatgcccccctaaacttgaaaatttata |
12231324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 14103882 - 14103795
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc-cgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| |||||||||| | |||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
14103882 |
ttctgttagttaacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccccatgaacttgaaaatttata |
14103795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 14413899 - 14413812
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc-cgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| |||||||||| | |||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
14413899 |
ttctgttagttaacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccccatgaacttgaaaatttata |
14413812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 22021893 - 22021940
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgc |
66 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
22021893 |
cttctgttagtcaacattacgttttgcaaataccccctgaagttttgc |
22021940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 37007181 - 37007248
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
37007181 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttacgtgcaaaatacccc |
37007248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18120374 - 18120460
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||| |||||||||||||||||| ||| | ||| ||||| ||||| |||||||||| |
|
|
| T |
18120374 |
ttctgttagtgaacatgatgttttggaaatacccccctgaagttttgcacttatgtgcgatatgtcccccaaacttaaaaatttata |
18120460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 21387200 - 21387150
Alignment:
| Q |
35 |
tgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
21387200 |
tgacattttgcaaatacccctctgaagttttgtacttatgtgcaaaatgcc |
21387150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Original strand, 37710694 - 37710744
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
37710694 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt |
37710744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 41798447 - 41798505
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
41798447 |
caaataccccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
41798505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22599453 - 22599377
Alignment:
| Q |
31 |
aacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||||| ||||||| ||||||||| ||| ||||||| || ||||||| |
|
|
| T |
22599453 |
aacatgacgttttgcaaatatactccctgaagttttacacttatgtgcaaaatgtcccacgaacttaaatatttata |
22599377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 86
Target Start/End: Original strand, 39880164 - 39880205
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39880164 |
caaataccccctgaaattttgcacttatgtgcaaaatgcccc |
39880205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 105
Target Start/End: Original strand, 45259058 - 45259107
Alignment:
| Q |
56 |
tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
45259058 |
tgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttata |
45259107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 19071597 - 19071649
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
19071597 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
19071649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 28294396 - 28294448
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
28294396 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
28294448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 35667917 - 35667969
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
35667917 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
35667969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 39767531 - 39767479
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
39767531 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
39767479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 42491418 - 42491342
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||| |||| ||||||||||| ||||||||| |||||| ||||||||| ||| ||||||| |||||||||| |
|
|
| T |
42491418 |
caacacgacgttttacaaatacccccctgaagttttatacttatgtgcaaaatgtccctcgaacttaaaaatttata |
42491342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 5852484 - 5852433
Alignment:
| Q |
31 |
aacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaat |
81 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
5852484 |
aacatgacgttttgcaaataccctcctgaagttttgcacttatgtacaaaat |
5852433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 105
Target Start/End: Original strand, 8296380 - 8296435
Alignment:
| Q |
50 |
accccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
8296380 |
accctctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
8296435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 104
Target Start/End: Complemental strand, 9495645 - 9495595
Alignment:
| Q |
53 |
ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||||||||||||||| || |||||| || |||||||||||||||||| |
|
|
| T |
9495645 |
ccctgaagttttgcacttatgtgtaaaatg-ccaccgaacttgaaaatttat |
9495595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 22598916 - 22598990
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| || ||||| |||||||||| | |||||||||| || ||||||||||||||||| |
|
|
| T |
22598916 |
aacatgacgttttgcaaatacacctctgaaattttgcacttttgtgcaaaatgcttcc-gaacttgaaaatttata |
22598990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 26932042 - 26931988
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttat |
72 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26932042 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttat |
26931988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 37711254 - 37711195
Alignment:
| Q |
45 |
caaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
37711254 |
caaatacccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
37711195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 48937176 - 48937109
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||| | ||||||||||| || || |||||||||||||||| ||||||||||||| |
|
|
| T |
48937176 |
ttctgttagtgaacatgtcgttttgcaaatatcctcttgaagttttgcacttatgtgcaaaatgcccc |
48937109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 12231967 - 12231909
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| |||| ||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
12231967 |
caaatatcccccgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
12231909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 99
Target Start/End: Complemental strand, 17775276 - 17775210
Alignment:
| Q |
34 |
atgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||| |||| ||||||| | |||||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
17775276 |
atgacgttttacaaatactctcctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaa |
17775210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 105
Target Start/End: Complemental strand, 26244493 - 26244463
Alignment:
| Q |
75 |
gcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26244493 |
gcaaaatgccccccgaacttgaaaatttata |
26244463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 105
Target Start/End: Original strand, 33210419 - 33210469
Alignment:
| Q |
55 |
ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
33210419 |
ctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttata |
33210469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 38449964 - 38450018
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
38449964 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttata |
38450018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 39766979 - 39767033
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||| | |||||||| ||||| |||||||||||||||| |
|
|
| T |
39766979 |
ccccctgaaattttgcacttctatgcaaaataccccctaaacttgaaaatttata |
39767033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 44157611 - 44157665
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
44157611 |
ccccttgaagttttgcacttatgtgcaaaatgcttcatgaacttgaaaatttata |
44157665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 47170347 - 47170400
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
47170347 |
ccccctgaggttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
47170400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 48344279 - 48344221
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| || |||||||||| ||||| |||||||| |
|
|
| T |
48344279 |
caaataccccctgaaattttgcacttatgtgataaatgccccctaaacttaaaaattta |
48344221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 1730192 - 1730139
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | | ||||| ||||| |||| |
|
|
| T |
1730192 |
cccctgaagttttgcacttatgtgcaaaatgcctctcaaacttaaaaatatata |
1730139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 16083139 - 16083192
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
16083139 |
cccctgaaattttgcacttatgtgcaaaatgacccttaaacttgaaaatttata |
16083192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 23677943 - 23678008
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||| |||||||| | | |||||||| |||||||||| |
|
|
| T |
23677943 |
ttttgcaaataccctgtgaaattttacacttatgtgcaaaatacactccgaacttaaaaatttata |
23678008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 103
Target Start/End: Original strand, 28311640 - 28311693
Alignment:
| Q |
50 |
accccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
28311640 |
accccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
28311693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 11456441 - 11456378
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaat |
81 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
11456441 |
ttctgttagtgaacatgacgttttgcaaatgtcccccctgaaggtttgcacttatgtgcaaaat |
11456378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 14313049 - 14313085
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
14313049 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
14313085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 28312468 - 28312432
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
28312468 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
28312432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 219)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 11652977 - 11653064
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11652977 |
cttctgttagtcaacatgacgttttgcaaatactcccctgaagtttttcacttatgtgcaaaatgccccccgaacttgaaaatttata |
11653064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 1033802 - 1033720
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
1033802 |
ttctgttagtcaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgcaaattt |
1033720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37704337 - 37704252
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37704337 |
ttctgttagtgaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37704252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42248954 - 42248869
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
42248954 |
ttctgttagtgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
42248869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 34503529 - 34503612
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34503529 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatatgcaaaatgccccccgaacttgaaaattt |
34503612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 50672588 - 50672501
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||| |||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
50672588 |
cttctgttagtcaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
50672501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 9103953 - 9103879
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9103953 |
aacatgaaattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9103879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32950977 - 32950891
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
32950977 |
ttctgttagtgaacatgacattttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
32950891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 44518994 - 44518920
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44518994 |
aacatgacattttgcaaataccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
44518920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35154017 - 35154102
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
35154017 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
35154102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 55481460 - 55481548
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
55481460 |
cttccgttagtcaacatgacattttgcaaatacccccactgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttata |
55481548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 884128 - 884042
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
884128 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
884042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3370757 - 3370671
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3370757 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3370671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 9718039 - 9718125
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
9718039 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
9718125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13341720 - 13341806
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13341720 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13341806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 14509298 - 14509384
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14509298 |
ttctgttagtaaacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccctccgaacttgaaaatttata |
14509384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 19238348 - 19238422
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
19238348 |
aacatgacattttgcaaataccccttgaagttttgcacttatgttcaaaatgcccccccaacttaaaaatttata |
19238422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 20495427 - 20495513
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20495427 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20495513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23323333 - 23323419
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23323333 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23323419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 24828242 - 24828156
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
24828242 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
24828156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 40792364 - 40792282
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
40792364 |
ttctgttagtcaacatgacattttgcaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaaatt |
40792282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 44518379 - 44518465
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
44518379 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
44518465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 52394545 - 52394631
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
52394545 |
ttctgttagtgaacatgacgttttgcaaatacccctatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
52394631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36027991 - 36027907
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
36027991 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
36027907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36736001 - 36736086
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36736001 |
ttctgttagtgaacatgacgttttgcaaataccctctgaatttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36736086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 39669544 - 39669459
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39669544 |
ttctgttagtgaacatgacgttttacaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39669459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 40791476 - 40791562
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc----ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40791476 |
tgttagtcaacatgacgttttgcaaataccccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
40791562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43727774 - 43727689
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
43727774 |
ttctgttagtgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttata |
43727689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5152498 - 5152585
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5152498 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
5152585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13737713 - 13737626
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13737713 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttata |
13737626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 24086846 - 24086759
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
24086846 |
ttctgttagtgaacatgacgttttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
24086759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 31584808 - 31584895
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||||| |||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
31584808 |
ttctgttagtcaacatgacgttttgcaaatacctcccctgaaattttgcacttatgtgcaaaatgccccctgagcttgaaaatttata |
31584895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 31585948 - 31586035
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31585948 |
ttctgttagtgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
31586035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36736628 - 36736541
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36736628 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36736541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40065610 - 40065697
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
40065610 |
ttctgttagtcaacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
40065697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 41222649 - 41222569
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaat |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
41222649 |
ttctgttagtcaacatgacattttgcaaatacctccctaagttttgcacttatgtgcaaaatgccccccaaacttaaaaat |
41222569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 23323950 - 23323875
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23323950 |
aacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23323875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 31582729 - 31582804
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31582729 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaaaatttata |
31582804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 40514899 - 40514825
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
40514899 |
aacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgc-ccccgaacttaaaaatttata |
40514825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 46976818 - 46976743
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
46976818 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccctaaacttaaaaatttata |
46976743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 52171669 - 52171594
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
52171669 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
52171594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 52961040 - 52961107
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
52961040 |
ttctgttagtgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaataccccc |
52961107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 54492840 - 54492927
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
54492840 |
cttctgttagtcaacatgacgttttgcaaatatttccctgaagttttgcacttatgtgcaaaatgccgcctgaacttgaaaatttata |
54492927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 883501 - 883587
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
883501 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttata |
883587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 10120655 - 10120569
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
10120655 |
ttctgttagtgaacatgacgttttgcaaatactccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
10120569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13342347 - 13342261
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
13342347 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
13342261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13737079 - 13737165
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
13737079 |
ttctgttagtgaacatcacgttttgcaaatacacccctaaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttata |
13737165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17053285 - 17053371
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
17053285 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
17053371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23781756 - 23781670
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23781756 |
ttctgttagtgaacatgacgttttgcaaatatccccctcaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23781670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23908473 - 23908559
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
23908473 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
23908559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25067668 - 25067754
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
25067668 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
25067754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26839280 - 26839365
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
26839280 |
ttctgttagtaaacatgacgttttgcaaatactcccctgaagttttacacttatgtgcaaaatg-cccccgaacttgaaaatttata |
26839365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31586579 - 31586493
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
31586579 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
31586493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35234965 - 35235051
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||| |||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
35234965 |
ttctgttagttaacatgacgttttgcaaatactcccctgaagttttgtacttatgtacaaaatgccccctgaacttgaaaatttata |
35235051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 105
Target Start/End: Original strand, 36027105 - 36027182
Alignment:
| Q |
30 |
caacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36027105 |
caacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36027182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40163162 - 40163248
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40163162 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40163248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 45258683 - 45258597
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||| | | ||||||||||||||||||||| |||||||||| |
|
|
| T |
45258683 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacatgtgtgcaaaatgccccccgaacttaaaaatttata |
45258597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 49255774 - 49255860
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
49255774 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
49255860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 49256401 - 49256315
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
49256401 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttata |
49256315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 53178365 - 53178451
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| || ||||||| |
|
|
| T |
53178365 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaatatttata |
53178451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 55153477 - 55153563
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
55153477 |
ttctgttagtgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
55153563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 55154104 - 55154018
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
55154104 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttata |
55154018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 55482332 - 55482247
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||| ||||||||||||||||||||| ||||||||| || | ||||||||||||||||| |
|
|
| T |
55482332 |
cttctgttagtcaacatgacgttt-gcaaatatcccctgaagttttgcacttatgtgcaaaatgtccactgaacttgaaaatttata |
55482247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24782212 - 24782297
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||| |||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
24782212 |
ttctgttaggcaacataacgttttccaaataccccctgaagttttgcacttatgtgcaaaatgtcccttaaacttgaaaatttata |
24782297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 42855867 - 42855952
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||| |||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
42855867 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttat |
42855952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 54627149 - 54627234
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||| |||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
54627149 |
ttctgttagtcaacataacgttttgcaaataacccctgaagtttcgcacttatgtgcaaaatgcccccaaaacttggaaatttata |
54627234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 36260119 - 36260035
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| || ||||| |||||||||||| |||||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
36260119 |
tctgttagtgaatatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
36260035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 38598991 - 38599078
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38598991 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
38599078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 25 - 105
Target Start/End: Complemental strand, 54801230 - 54801150
Alignment:
| Q |
25 |
ttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||||| || |||||||||||| | |||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
54801230 |
ttagtcaacatcacgttttgcaaatactctctgaagttttgcacttatgtgcaaaatgccacccgaacttgaaaaattata |
54801150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 9667293 - 9667206
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||| |||||||||||||||||| | |||||||||||||||| ||||||||||||||| |
|
|
| T |
9667293 |
cttctgttagtcaacatgacgttttgttaatacttccctgaagttttgcacttctatgcaaaatgccccccggacttgaaaatttata |
9667206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 35 - 105
Target Start/End: Original strand, 10656218 - 10656289
Alignment:
| Q |
35 |
tgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
10656218 |
tgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
10656289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 20819355 - 20819430
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
20819355 |
aacatgacgttttgcaaatacccccttgaagttttgtacttatgtgcaaaatgccccctgaacttaaaaatttata |
20819430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 29006649 - 29006724
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
29006649 |
ttctgttagcgaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaactt |
29006724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 98
Target Start/End: Original strand, 34921416 - 34921491
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
|||||| ||||||||| ||||||||||| ||| ||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
34921416 |
tgttagtcaacatgacgttttgcaaatatcccttgaagttttgcacttatgtgcaaaatgtcctccgaacttgaaa |
34921491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 37332721 - 37332808
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||||| |||||||||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
37332721 |
cttctgttagtcaacatcatgttttgcaaatacccccttgaagttttgcacttgtgtgcaaaatgccttccgaacttgaaaatttata |
37332808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 40066541 - 40066466
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
40066541 |
aacatgacattttgcaaatacccccctgaagttttgtacttatgttcaaaatgccccctaaacttgaaaatttata |
40066466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 41221808 - 41221895
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||||| |||| ||||| || ||||| |||||| |||||||||| |
|
|
| T |
41221808 |
cttctgttagtcaacatgacattttgcaaatacccccctgaaattttgcatttatgtgcaagataccccctgaacttaaaaatttata |
41221895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 52171066 - 52171141
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
52171066 |
aacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
52171141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 54800191 - 54800274
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaac-ttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||||||| |||| || |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
54800191 |
tgttagtcaacatcacattttacaaataccccctgaaattttacatttatgtgcaaaatgccccccgaactttgaaaatttata |
54800274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 2445206 - 2445124
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||| |||||||||||||| || ||||||||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
2445206 |
tgttagtcaacatgaagttttgcaaatacccactaaagttttgcacttatgtgcaaaatgcttccctaacttgaaaatttata |
2445124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6071740 - 6071652
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc---tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
6071740 |
ttctgttagtgaacatgacattttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgccctcaaaacttaaaaatttata |
6071652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 24 - 105
Target Start/End: Complemental strand, 7580542 - 7580461
Alignment:
| Q |
24 |
gttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||| |||||||||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
7580542 |
gttagccaatatgacgttttgtaaatacccctctgaagttttgcacttatgtgcaaaatgc-ccccaaacttgaaaatttata |
7580461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 19239904 - 19239830
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| |||||||| || |||||| || |||||||||| |
|
|
| T |
19239904 |
aacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaatttaaaaatttata |
19239830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 20189517 - 20189431
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| ||||||||| ||||| ||| | |||||||||| |
|
|
| T |
20189517 |
ttctgttagtgaacatgacattttacaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacataaaaatttata |
20189431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 21627389 - 21627475
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| |||||||||||||||||| || |||||| ||||| ||||| |||||||||| |
|
|
| T |
21627389 |
ttctgttagggaatatgacattttgcaaatacccccctgaagttttgcacttatgtgaaaaatgtcccccaaacttaaaaatttata |
21627475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23781129 - 23781215
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||| || ||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23781129 |
ttctgttagtgaacataacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23781215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 24783144 - 24783058
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||| ||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24783144 |
ttctgttagttaacatgacgttttgcaaattcccccccgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
24783058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32751749 - 32751663
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||| |||||| ||||||||||| || ||| ||||||||||||| |
|
|
| T |
32751749 |
ttctgttagttaacatgacgttttgcaaatactcccctgaagttttgtacttatgtgcaaaatgcctcctgaatttgaaaatttata |
32751663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 33305907 - 33305833
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
33305907 |
aacatgacgttttgtaaataccacctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
33305833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 36791724 - 36791638
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| |||| |||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
36791724 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
36791638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 37703712 - 37703797
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||| || || |||||||||| |
|
|
| T |
37703712 |
ttctgttagtaaacatgacattttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaatttaaaaatttata |
37703797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 42389502 - 42389588
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctg-aagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||||||| |||||||||||| || ||||| |||||||||| |
|
|
| T |
42389502 |
ttctgttagtgaacatgacgttttgcaaataccccctttaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttata |
42389588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 47799118 - 47799204
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||| ||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
47799118 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgcccccaaaacttaaaaatttata |
47799204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 54603188 - 54603102
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
54603188 |
ttctgttagttaacatgacattttgcaaatatcttcctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttata |
54603102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 987256 - 987337
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaat |
100 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
987256 |
ttctgttagtgaacatgatgttttgcaaatacccccttgaagttttgcacttatatgcaaaatgccccccaaactggaaaat |
987337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 5153128 - 5153043
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| || |||||| |||| ||||| |||||||||| |
|
|
| T |
5153128 |
ttctgttagtgaacatgacgttttgcaaataccccccgaagttttgcacttatgtgaaaaatgttccccaaacttaaaaatttata |
5153043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18073899 - 18073814
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||| ||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
18073899 |
ttctgttagtgaacatgacgttttgcaaataccccctaaagtttttcacttatgcgcaaaatgcccctcaaacttaaaaatttata |
18073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 20496055 - 20495979
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
20496055 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt |
20495979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 29006854 - 29006778
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
29006854 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttata |
29006778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40783402 - 40783317
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||| ||| |||||||||||| ||||||||||||||| ||||| ||| |||||| |
|
|
| T |
40783402 |
ttctgttagtgaacatgacgttttgcaaatatcccccgaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttata |
40783317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44405346 - 44405262
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| | ||||||||||||||| ||||||||| |||| |||||| |||||||||| |
|
|
| T |
44405346 |
ttctgttagtaaacatgacgttttgcaaatacccc-taaagttttgcacttatgtgcaaaatgtcccctgaacttaaaaatttata |
44405262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 54602251 - 54602336
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || ||||| ||||| |||| |||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
54602251 |
ttctgttagtcaacataacgttttgtaaatatcccccgaagttttgcacttatgtgcaaaatgccccataaacttgaaaatttata |
54602336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 4238338 - 4238270
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4238338 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccc |
4238270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 6071118 - 6071185
Alignment:
| Q |
40 |
ttttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6071118 |
ttttgcaaataccccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6071185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 10657126 - 10657040
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
10657126 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
10657040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 20186526 - 20186594
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20186526 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
20186594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23581847 - 23581934
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||| |||||||||||||||| |||||| |||||||| ||||| |||||||||| |
|
|
| T |
23581847 |
ttctgttagtgaacatgacgttttgcaaatatcccctctgaagttttgcacttatgtgcaaactgccccccaaacttaaaaatttata |
23581934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24086217 - 24086304
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| ||| |||||| |
|
|
| T |
24086217 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaattttata |
24086304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 31583346 - 31583259
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
31583346 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttacacttatgtacaaaatgccccccaaacttaaaaatttata |
31583259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 43727148 - 43727235
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| | ||| ||||| |||||||||| |
|
|
| T |
43727148 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttata |
43727235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 50314419 - 50314351
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
50314419 |
cttctgttagtcaacatcacgttttgcaaataccccctgaaattttgcacttatgtgcaaaataccccc |
50314351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 53628202 - 53628115
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||| ||||||||||||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
53628202 |
ttctgttagtgaacatgacgttttgcaaatacaccccatgaagttttgcacttatgttcaaaatgccccccaaacttaaaaatttata |
53628115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 1092147 - 1092222
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||| |||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
1092147 |
aacaagacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctgaacttgaaaatttata |
1092222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 4490365 - 4490279
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | ||||||||||| |||||||| ||||||||| | || ||||||||||||||| |
|
|
| T |
4490365 |
ttctgttagtcaacatgacattttgcaaatatctcccctgaagtttagcacttatgtgcaaaatgttctccaaacttgaaaatttat |
4490279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 4584137 - 4584212
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |||||||| |||||| ||||| |||||||||| |
|
|
| T |
4584137 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttata |
4584212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 105
Target Start/End: Original strand, 8014742 - 8014813
Alignment:
| Q |
35 |
tgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| || ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8014742 |
tgacgttttgcaaatacccccctgaagttttgcactgatgtgcaaaatgccccccaaacttaaaaatttata |
8014813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 35235902 - 35235819
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||||| ||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
35235902 |
tgttagtcaacataacgttttgcaaataccctcctgaagttttgcacttatgcgaaaaatgccccctaaacttgaaaatttata |
35235819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 38599619 - 38599534
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| ||||||||| |
|
|
| T |
38599619 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttat |
38599534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 39668926 - 39669000
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
39668926 |
aacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
39669000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 47799728 - 47799654
Alignment:
| Q |
31 |
aacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
47799728 |
aacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
47799654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 49527922 - 49527847
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
49527922 |
aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgtcccccaaacttcaaaatttata |
49527847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9718665 - 9718580
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| ||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
9718665 |
ttctgttagtaaacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgcccccc-aaatttaaaatttata |
9718580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 10120027 - 10120112
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||| |||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
10120027 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
10120112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 19961639 - 19961705
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||| |||||||| ||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19961639 |
tctgttagtgaacatgacgttttgcaaacacctcctgaagttttgcacttatgtgcaaaatgccccc |
19961705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 20411189 - 20411103
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| | ||||| ||||| |||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
20411189 |
ttctgttagttaacatgacattttccaaatacctcactgaaattttgtacttatgtgcaaaatgccccctgaatttgaaaatttata |
20411103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 21628016 - 21627930
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||| | ||||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
21628016 |
ttctgttagtgaacataacgttttgcaaacaaccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
21627930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 24376863 - 24376777
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||||||||| |||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
24376863 |
cttctgttagtgaacatgacattttgcaaatatttcatgaagttttgcatttatgtgcaaaatgccccccaaactcaaaaatttata |
24376777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 24814199 - 24814284
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24814199 |
ttctgttagtgaatatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
24814284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32750806 - 32750892
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||| | |||||||||| |||||| |
|
|
| T |
32750806 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaattttata |
32750892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 35154631 - 35154557
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||| |||||||| ||| || ||||| |||||||||| |
|
|
| T |
35154631 |
aacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttata |
35154557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 35234778 - 35234709
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
35234778 |
cttctgttagtcaacatgacgttttgcaaataccccctctgaagttttgcaattatgtgcaaaatgcccc |
35234709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 36259495 - 36259581
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| || ||||||| |
|
|
| T |
36259495 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaagatttata |
36259581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 42248074 - 42248147
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| ||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
42248074 |
aacatgacgttttgcaaataccccctgaaattttacacttatgtgcaaaat-acccccgaacttgaaaatctata |
42248147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 87
Target Start/End: Original strand, 45712540 - 45712602
Alignment:
| Q |
25 |
ttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45712540 |
ttagtcaacatgatgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccc |
45712602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 46651140 - 46651054
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||| |||||| ||||||||| | || |||||| |||||||||| |
|
|
| T |
46651140 |
ttctgttagttaacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatggctcctgaactttaaaatttata |
46651054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 23 - 99
Target Start/End: Original strand, 9665619 - 9665696
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
|||||| |||||||| |||||||||||| || |||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
9665619 |
tgttagtcaacatgatgttttgcaaatacaccgctgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaa |
9665696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 25068306 - 25068237
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
25068306 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccc |
25068237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 29587256 - 29587308
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29587256 |
cccctgaagttttgcacttatttgcaaaatg-ctcccgaacttgaaaatttata |
29587308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 34922123 - 34922039
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||| | ||||||||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
34922123 |
cttctgttagtcaacataaagttttgcaaatacctc-tgaagttttgcacttatgtgcaaaatgctcccataacttgaaaatttat |
34922039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 40009443 - 40009519
Alignment:
| Q |
31 |
aacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| | ||||||||| | ||||||||||||||||| |
|
|
| T |
40009443 |
aacatgacattttgcaaatatcccccctgaagttttgcatttatgtacaaaatgcctcatgaacttgaaaatttata |
40009519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 42856753 - 42856677
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
42856753 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccccaaaacttaaaaatttata |
42856677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 11653772 - 11653716
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
11653772 |
aacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaataccccc |
11653716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 33305278 - 33305342
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
33305278 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgc |
33305342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 34941664 - 34941577
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||| || ||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
34941664 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagtcttacacttatgtgcaaaatgcctcccaaacttaaaaatttata |
34941577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 52395125 - 52395057
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
52395125 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccc |
52395057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 45 - 104
Target Start/End: Original strand, 1586977 - 1587036
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
1586977 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat |
1587036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 8015604 - 8015517
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||| | ||||||||| ||||||| || ||||||||||||| | |||| |||||| ||||||||||||||||| |
|
|
| T |
8015604 |
cttctgttagtcaacatggcgttttgcaaacacccccttaaagttttgcacttatgtacaaattgccccttgaacttgaaaatttata |
8015517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 40782789 - 40782863
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||| |||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
40782789 |
aacatgacgttttgcaaatacccctctaaagttttgcatttatgtgcaaaatg-cccccgaacttaaaaatttata |
40782863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 35233874 - 35233948
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| | ||||||||||||||| || | |||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
35233874 |
aacatggcgttttgcaaataccccatggaattttgcacttatgtgcaaaatgtcccttgaacttgaaaatttata |
35233948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37117138 - 37117052
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||| |||| |||||| ||||||||||||||| ||||||||||| |||||||| | |||||||| |
|
|
| T |
37117138 |
ttctgttagtcaacataacgttttgctaatatccccctaaagttttgcacttatgtgcaaaatgccatccgaactttagaatttata |
37117052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 38667270 - 38667324
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
38667270 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
38667324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38771773 - 38771687
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||| |||||||||||| ||||||||| ||| ||||| |||||||||| |
|
|
| T |
38771773 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaatttttgcacttatgtgcaaaatgttcccaaaacttaaaaatttata |
38771687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42803146 - 42803060
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||| || ||||||| |||| |||||||||||||||| |
|
|
| T |
42803146 |
ttctgttagtgaacatgacgttttgcaaataccccgctgaagttttgcactgatgtgcaaaaatgccccaaaacttgaaaatttata |
42803060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 7579942 - 7580018
Alignment:
| Q |
30 |
caacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||||||||||| |||||||||| |||| || || ||||||||| |
|
|
| T |
7579942 |
caacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgctccccaaaattaaaaatttat |
7580018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 23909090 - 23909014
Alignment:
| Q |
31 |
aacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||| |||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
23909090 |
aacatgacgtttggcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccatacttaaaaatttata |
23909014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 31585281 - 31585201
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| |||| | |||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
31585281 |
ttctgttagtcaacatgacgttttgcaaatatcccccca-gttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
31585201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 39285063 - 39285124
Alignment:
| Q |
45 |
caaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
39285063 |
caaataccctcctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
39285124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 49223662 - 49223577
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| |||| |||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
49223662 |
ttctgttagcgaacatgacgttttgcaaatacccccctaaaagtgttgcacttatatgcaaaatg--caccgaacttgaaaatttata |
49223577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 49316193 - 49316246
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
49316193 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
49316246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 10473756 - 10473696
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
10473756 |
caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
10473696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 2444463 - 2444517
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcactta |
71 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
2444463 |
cttctgttagtcaacatgacgttttgcaaataccctccctgaagttttgcactta |
2444517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 42390116 - 42390042
Alignment:
| Q |
31 |
aacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| || ||||||| |||| ||||| |||||||||| |
|
|
| T |
42390116 |
aacatgacgttttgcaaatattcccctgaagttttgcacttatgtgtaaaatgc-ccccaaacttaaaaatttata |
42390042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 54493629 - 54493542
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||| |||| ||||||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
54493629 |
cttctgttagtttacatgacgttttgtaaatacctccctcaagttttgcacttatgtgcaaaatgctccctcaacttaaaaatttata |
54493542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 3021219 - 3021273
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
3021219 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
3021273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 3937724 - 3937778
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
3937724 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaaattata |
3937778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 9103383 - 9103456
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||| ||||||| ||||||||| |||||||||| |||| ||||| |
|
|
| T |
9103383 |
aacatgacgttttgcaaatagcccctgaggttttacacttatgtgcaaaatg-tccccgaacttaaaaacttata |
9103456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 14899397 - 14899343
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
14899397 |
ccccttgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
14899343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 47 - 105
Target Start/End: Original strand, 17753960 - 17754018
Alignment:
| Q |
47 |
aataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||||| || ||||||||||||| |
|
|
| T |
17753960 |
aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttata |
17754018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 47 - 105
Target Start/End: Original strand, 19055280 - 19055338
Alignment:
| Q |
47 |
aataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||||| || ||||||||||||| |
|
|
| T |
19055280 |
aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttata |
19055338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 26839483 - 26839409
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||| |||||||| ||||| || || |||||||||| |
|
|
| T |
26839483 |
aacatgaagttttgcaaatatcccctgaagttttgcacttacgagcaaaatgtcccccaaatttaaaaatttata |
26839409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 30835109 - 30835182
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| ||| ||||||||| | | ||||||| |||||||||| |
|
|
| T |
30835109 |
aacatgatgttttgcaaatacgccctgaagttttgcacatatgtgcaaaatg-ctctcgaactttaaaatttata |
30835182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 33129286 - 33129201
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||| |||||| || |||||||||||| ||||||||||||||| |||| | ||||||| |||| ||||| |||||||||| |
|
|
| T |
33129286 |
cttctattagtcaacataacgttttgcaaatactccctgaagttttgca-ttatgtacaaaatggccccaaaacttaaaaatttata |
33129201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 33982109 - 33982051
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
33982109 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaattta |
33982051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 36951845 - 36951791
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
36951845 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
36951791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 39172485 - 39172419
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccc |
85 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
39172485 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccc |
39172419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 40278262 - 40278316
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
40278262 |
ccccctaaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
40278316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 42802131 - 42802204
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || |||| ||||||||| || ||||||||||||||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
42802131 |
aacataacgttttacaaataccctctaaagttttgcacttatgtgcaaaatg-tccccgaacttaaaaatttata |
42802204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 52961629 - 52961576
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
52961629 |
ccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
52961576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 55117174 - 55117101
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||| |||||||| |||||| |||| |||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
55117174 |
aacatgacgttttacaaatacctcctgaatttttacacttatttgcaaaat-acccccaaacttaaaaatttata |
55117101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 4070458 - 4070405
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
4070458 |
cccctgaaattttgcacttatgtgcaaaataccccctaaacttgaaaatttata |
4070405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 35547104 - 35547169
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| ||||||||||| || |||||||| ||||||||| ||||||||||||| |
|
|
| T |
35547104 |
ttttgcaaacacccccagaagttttgcatctaagtgcaaaataccccccgaatttgaaaatttata |
35547169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 45148933 - 45148994
Alignment:
| Q |
45 |
caaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
45148933 |
caaatacccctctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttata |
45148994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 46975964 - 46976043
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||| |
|
|
| T |
46975964 |
ttctgttagtgaacatgacgtttttcaaataccca-tgaagttttgcacttatgtgcaaaatgtccccc-aacttaaaaatt |
46976043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 1587812 - 1587760
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
1587812 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
1587760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 13268585 - 13268645
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||| ||| |||| |||||||||||||| || ||||||||||||| |
|
|
| T |
13268585 |
caaataccccctgaaatttggcatttatgtgcaaaatgccccctaaatttgaaaatttata |
13268645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 14898881 - 14898933
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
14898881 |
ccccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaattta |
14898933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 21414444 - 21414496
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
21414444 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
21414496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 29589025 - 29588950
Alignment:
| Q |
30 |
caacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
29589025 |
caacatgacgttttgcaaatacttctctgaagttttgcacttatgtgcaaaatg-tccgtgaacttgaaaatttata |
29588950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 33128535 - 33128622
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||| |||| |||||||| | ||||| ||| |||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
33128535 |
ttctgttaatcaacatgacgttttccaaatacctctcctgaaatttcgcacttatgtgcaaaatgtcccttgaacttgaaaatttata |
33128622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 86
Target Start/End: Complemental strand, 40010128 - 40010076
Alignment:
| Q |
35 |
tgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
40010128 |
tgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatacccc |
40010076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 105
Target Start/End: Complemental strand, 987894 - 987847
Alignment:
| Q |
58 |
aagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
987894 |
aagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
987847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 38770423 - 38770485
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
38770423 |
ttctgttagtgaacctgacgttttgcaaatacccc-tgaagttttgcacttatatacaaaatgc |
38770485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 43914664 - 43914602
Alignment:
| Q |
45 |
caaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
43914664 |
caaataccccccttgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttata |
43914602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 53627316 - 53627390
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||| |||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
53627316 |
aacatgacgttttgcaaatgtccccctaaagttttgaacttatgtgcaaaatg-cccccaaacttaaaaatttata |
53627390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 6779818 - 6779893
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaa |
97 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
6779818 |
cttctgttagttaacatgacgttttgcaaatatccccctgaagttttacacta----gcaaaatgtcccccgaacttgaa |
6779893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 22847851 - 22847797
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||| ||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22847851 |
ccccttgaaattttacacttatgtgcaaaatgccccctaaacttgaaaatttata |
22847797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 33777658 - 33777715
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| |||||||||| ||||| |||||||| |
|
|
| T |
33777658 |
caaataccccctgaaattttgcacttatgtgc-aaatgccccctaaacttaaaaattta |
33777715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 33981550 - 33981604
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| ||||||||||| |||| |
|
|
| T |
33981550 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatatata |
33981604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 36791164 - 36791217
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcactta |
71 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36791164 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcactta |
36791217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 43354505 - 43354447
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| | |||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
43354505 |
caaatatcgcctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
43354447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 45257956 - 45258025
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
45257956 |
ttctgttagtgaacatgatgttttgcaaatacctcccctgaagttttacacttatgtgcaaaatgtcccc |
45258025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 54628087 - 54628022
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
54628087 |
ttctgttagttaacatgacgttttacaaataccccctctgaagttttgtacttatgtgcaaaatgc |
54628022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 4489093 - 4489146
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcactta |
71 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
4489093 |
cttctgttagtcaacatgatgttttgcaaatacccccataaagttttgcactta |
4489146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Complemental strand, 25360291 - 25360242
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaa |
80 |
Q |
| |
|
|||||||| ||||||||||||||| | |||| |||||||||| ||||||| |
|
|
| T |
25360291 |
aacatgactttttgcaaataccccttaaagtattgcacttatgtgcaaaa |
25360242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 105
Target Start/End: Complemental strand, 25556300 - 25556252
Alignment:
| Q |
56 |
tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
25556300 |
tgaagttttgcacttatgtgcaaaatatcccccgaactt-aaaatttata |
25556252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 26035052 - 26034969
Alignment:
| Q |
21 |
tctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||| ||||||||| ||| ||| ||||||||| || |||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
26035052 |
tctgttagtcaacatgatattttgcaa-tactcccatgaagttttacatttatgtgcaaaatgc-ccccaaacttaaaaatttata |
26034969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 29492149 - 29492209
Alignment:
| Q |
45 |
caaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||| ||| |||||||||||| ||||||||| | ||| |||||||||||||||| |
|
|
| T |
29492149 |
caaatacccccttgaaattttgcacttatgtgcaaaatg-ctccctaacttgaaaatttata |
29492209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 39285341 - 39285281
Alignment:
| Q |
45 |
caaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
39285341 |
caaatacccccactgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
39285281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 103
Target Start/End: Complemental strand, 40279106 - 40279057
Alignment:
| Q |
54 |
cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
40279106 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
40279057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 50314360 - 50314319
Alignment:
| Q |
46 |
aaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
50314360 |
aaataccccctgaaattttgcacttatgtgcaaaattccccc |
50314319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 72
Target Start/End: Original strand, 53757844 - 53757892
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttat |
72 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
53757844 |
tgttagtcaacatgacgttttgcaaatatcccc-gaagttttgcacttat |
53757892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 3022169 - 3022117
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
3022169 |
ccccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaattta |
3022117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 6459604 - 6459572
Alignment:
| Q |
73 |
ttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
6459604 |
ttgcaaaatgccccctgaacttgaaaatttata |
6459572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 21414704 - 21414656
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| | |||||| |||| |
|
|
| T |
21414704 |
ccccctgaaattttgcacttatgtgcaaaatgcccactgaactttaaaa |
21414656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 27656225 - 27656189
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
27656225 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
27656189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 38667768 - 38667716
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
38667768 |
ccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaattta |
38667716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 40512462 - 40512525
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| ||| |||| |||| ||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
40512462 |
ttctgttagtgaacttgacgtttttcaaataccccc-gaagttttgcacttatgtacaaaatgcc |
40512525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 45969477 - 45969529
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||| ||||| |||||||| |
|
|
| T |
45969477 |
ccccctgaaattttgcactcatgtgcaaaatgccccctaaacttaaaaattta |
45969529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 49316739 - 49316687
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
49316739 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
49316687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 124)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 35059196 - 35059113
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35059196 |
tgttagtcaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
35059113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 22064616 - 22064542
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22064616 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
22064542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1550106 - 1550191
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1550106 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1550191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 17816200 - 17816115
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
17816200 |
ttctgttagtaaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttaaaaatttata |
17816115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 21545338 - 21545253
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||| ||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
21545338 |
cttcggttagtcaacataacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttat |
21545253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25774923 - 25775008
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25774923 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25775008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26368080 - 26367995
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26368080 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26367995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 5606914 - 5607001
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
5606914 |
cttctgctagtcaacatgacattttgcaaatacctcactgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttata |
5607001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 12138610 - 12138688
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
12138610 |
ttctgttagtcaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaa |
12138688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 3362815 - 3362900
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
3362815 |
ttctgttagtgaacatgacgttttgcaaataccccttgaagttttgcacttatatgcaaaatgccccgcaaacttgaaaatttata |
3362900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 105
Target Start/End: Original strand, 4646038 - 4646103
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4646038 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccctaaacttgaaaatttata |
4646103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7532030 - 7532114
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
7532030 |
ttctgttagtaaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatg-cccccgaacttgaaaatttata |
7532114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12178680 - 12178595
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12178680 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttata |
12178595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 1091326 - 1091243
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
1091326 |
tgttagtcaacataacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttata |
1091243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 3106272 - 3106359
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3106272 |
cttctgttagtcaacatgatgttttgcaaatacccccaagaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
3106359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 14251982 - 14252069
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| || ||||||||||||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
14251982 |
cttctgttagtcaacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaataccccccgaacttaaaaatttata |
14252069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 21540427 - 21540514
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||| |||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
21540427 |
cttctgttagtcaacatgacgttttgcaaatatccccctgaatttttgcacttatgtacaaaatgccccccgaagttgaaaatttata |
21540514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 122231 - 122145
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
122231 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
122145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 12178054 - 12178140
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12178054 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12178140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 19223616 - 19223530
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
19223616 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
19223530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 25775540 - 25775454
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25775540 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
25775454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 28243367 - 28243281
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
28243367 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
28243281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 36207095 - 36207181
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| ||||||||||||| || |||||| ||| ||||||||||||||||| |
|
|
| T |
36207095 |
cttctgttagtcaacatgacgttttgcaaataccccctgatgttttgcacttatgtgtaaaatgtcccatgaacttgaaaatttata |
36207181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 37224581 - 37224667
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
37224581 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
37224667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 38964873 - 38964787
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
38964873 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
38964787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40650876 - 40650962
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40650876 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40650962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 40651503 - 40651417
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
40651503 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
40651417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 4357454 - 4357369
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
4357454 |
ttctgttagtgaacatgacgttttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
4357369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 16057397 - 16057481
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
16057397 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
16057481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 23849071 - 23849159
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
23849071 |
cttctgttagtcaacatgatgttttgcaaataccccccctgaagttttgcaattatgtgcaaaatgtcccccgaacttgaaaatttata |
23849159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 32892223 - 32892308
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||| |||||| |
|
|
| T |
32892223 |
ttctgttagtgaagatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaattttata |
32892308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1550705 - 1550618
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1550705 |
ttctgttagtaaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1550618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 3074961 - 3074874
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
3074961 |
ttctgttagcgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
3074874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 3434565 - 3434652
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
3434565 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
3434652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41799323 - 41799410
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41799323 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 3107042 - 3106955
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
3107042 |
cttctattagtcaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttata |
3106955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 3435147 - 3435080
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3435147 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatgccccc |
3435080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 7338823 - 7338736
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||| |||||||||||||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
7338823 |
cttctgttagtcaacataactttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccctccaaacttgaaaatttata |
7338736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 9707996 - 9708079
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
9707996 |
tgttagtcaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
9708079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 41799940 - 41799865
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41799940 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
41799865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 3910319 - 3910385
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3910319 |
ttcttttagccaacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
3910385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 9708943 - 9708857
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| |||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
9708943 |
ttctgttagttaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccctgaactttaaaatttata |
9708857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 22482057 - 22481971
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22482057 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22481971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 26367454 - 26367540
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26367454 |
ttctgttagtgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26367540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41425538 - 41425624
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
41425538 |
ttctgttagtcaatatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccatgaacttgaaaatttata |
41425624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 44258123 - 44258196
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
44258123 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
44258196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 4356837 - 4356913
Alignment:
| Q |
31 |
aacatgacattttgcaaatacc--ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4356837 |
aacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
4356913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 22487269 - 22487345
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22487269 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22487345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 32892848 - 32892763
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
32892848 |
ttctgttagtgaacatgaagttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttata |
32892763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 44 - 105
Target Start/End: Original strand, 38935868 - 38935929
Alignment:
| Q |
44 |
gcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
38935868 |
gcaaataccccctgaagttttgcacttatgtgcaaaatgccccgtgaacttgaaaatttata |
38935929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39939399 - 39939484
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||| |||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
39939399 |
ttctgttagtcaacatgaagttttgcaaatatcccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaatttata |
39939484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 44747960 - 44747875
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
44747960 |
ttctgttagtgaacatgacgttttggaaataccccctaaagttttgcacttatgtgcaaaatgcccatcgaacttaaaaatttata |
44747875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 2695834 - 2695747
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc--cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| | |||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
2695834 |
ttctgttagtgaacatgacgtcttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
2695747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8345887 - 8345974
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
8345887 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
8345974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 15830902 - 15830827
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
15830902 |
aacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatgccccctaaacttgaaaatttata |
15830827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 35058306 - 35058392
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| |||| |||||| ||||||||| |||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
35058306 |
cttctgttagtcaatatgacgttttacaaatatccccctgaaattttgcacttatgtgcaaaatg-cccccgaacttgaaaatttata |
35058392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 36566449 - 36566374
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
36566449 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
36566374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 39500982 - 39500907
Alignment:
| Q |
31 |
aacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
39500982 |
aacatgaagttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
39500907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42793764 - 42793677
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcc-ccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||| ||||| |||||||||| |
|
|
| T |
42793764 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttata |
42793677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 45630045 - 45630132
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatg-ccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||||| ||||| |||||||||| |
|
|
| T |
45630045 |
ttctgttagtgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttata |
45630132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 121605 - 121690
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
121605 |
ttctgttagtgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
121690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 5607524 - 5607438
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||||||||||| |||| || ||||| | || ||||||||||||||||| |
|
|
| T |
5607524 |
cttctgttagtcaacatgacgttttgcaaataccccatgaagttttgcagttatgtgggaaatgtcacctgaacttgaaaatttata |
5607438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 6166307 - 6166393
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
6166307 |
ttctgttagtgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatggccccaaaacttaaaaatttata |
6166393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7777585 - 7777671
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||| |||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
7777585 |
ttctgttagcgaacatgacgttttgcaaatacctccctgaagttttgtacttatgtgcaaaatatcccccaaacttaaaaatttata |
7777671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 12139332 - 12139246
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||| || |||||||||||||| |||||||||| | |||||||| |||||||||| |
|
|
| T |
12139332 |
ttctgttagtcaacataacgttttgcaaatacccccctgcagttttgcacttatgtgcaaaatgctctccgaactttaaaatttata |
12139246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13700408 - 13700494
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| || || |||||||||| |
|
|
| T |
13700408 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaatttaaaaatttata |
13700494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25991986 - 25992071
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
25991986 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
25992071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 28242739 - 28242824
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
28242739 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
28242824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 33008466 - 33008381
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||| ||| |||||||||||| ||||| |
|
|
| T |
33008466 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaaattata |
33008381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 33869751 - 33869837
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| || | |||||||||| |
|
|
| T |
33869751 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaattgaaaaatttata |
33869837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 34926033 - 34925951
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||||| | |||| |||||||||||||| |||||||||||| |
|
|
| T |
34926033 |
ttctgttagtcaacatgacgttttgcaaatacccccctgaagttttgtagttatgtgcaaaatgccccctaaacttgaaaatt |
34925951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 40598544 - 40598630
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| | |||||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
40598544 |
ttctgttagtgaacatgacgttttgcaaatatcaccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
40598630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 7277900 - 7277984
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||||||||||||| ||| |||| ||||| | ||||||||||||||| |
|
|
| T |
7277900 |
tgttagtcaacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcgaaattccccctggacttgaaaatttata |
7277984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 41 - 105
Target Start/End: Complemental strand, 16058001 - 16057936
Alignment:
| Q |
41 |
tttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16058001 |
tttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
16057936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 28636227 - 28636307
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
28636227 |
ttctgttagtaaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaattccccccgaacttgaaa |
28636307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 36208002 - 36207937
Alignment:
| Q |
40 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| | | ||||||||||||||||| |
|
|
| T |
36208002 |
ttttgcaaataccccctaaagttttgcacttatgtgcaaaatgctctctgaacttgaaaatttata |
36207937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 42793137 - 42793205
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
42793137 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
42793205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 4647020 - 4646937
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| ||||||||||| | ||||||||||||||||||| |||||||| ||||| ||| ||||||||||||| |
|
|
| T |
4647020 |
tgttagtcaacatgacgttttgcaaatatcttcctgaagttttgcacttatgtgcaaaatcccccctgaatttgaaaatttata |
4646937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 7275598 - 7275515
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||||||| |||| |||||| | |||| ||||||||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
7275598 |
tgttagtcaacatgacgttttacaaatatctccctaaagttttgcacttatgttcaaaatgccccccaaacttgaaaatttata |
7275515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 8307426 - 8307339
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||| || |||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
8307426 |
cttctgttaatcaacatgacgttttgcaaatattcccctaaaattttacacttatatgcaaaatgtcccccgaacttgaaaatttata |
8307339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 28638069 - 28637994
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
28638069 |
aacatgaagttttgcaaatacctccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
28637994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5440219 - 5440305
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||| ||||| |||| |||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
5440219 |
ttctgttagtaaacatgacgttttgcgaatactcccttgaagttttgcacttatgtgcaaaatgcccctcaaactttaaaatttata |
5440305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 19222990 - 19223075
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
19222990 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg-accccaaacttaaaaatttata |
19223075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39500391 - 39500477
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||| || |||||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39500391 |
ttctgttagtaaacatgacgttttgtaaataccctcttgaagttttacacttatgtgcaaaatatcccccgaacttgaaaatttata |
39500477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 3074382 - 3074439
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
3074382 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
3074439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 22064038 - 22064114
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
22064038 |
aacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
22064114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 37225202 - 37225113
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac----cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||| ||||||||||||||||| ||||||||||||||| ||||| |||| ||||| |
|
|
| T |
37225202 |
ttctgttagagaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttata |
37225113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 20463658 - 20463575
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||||| ||| |||||||||||| |||| |||||||| ||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
20463658 |
tgttagtcaacacgacgttttgcaaatactcccttgaagttttacacttatgtgcaaaatgctccttgaacttgaaaatttata |
20463575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 33437969 - 33437902
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
33437969 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
33437902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8346509 - 8346423
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| | ||||||||||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
8346509 |
ttctgttagtgaacatgacgttttgcaaatattctcctgaagttttgcacttatgtgcaaaatgcttcccaaacttaaaaatttata |
8346423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 20207777 - 20207692
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||| || |||| ||||||||||| || |||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
20207777 |
cttctgttagtcaacatcacgttttaaaaataccccctaaaattttgcacttatgtgcaaaat-acccctgaacttgaaaatttata |
20207692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 33437344 - 33437390
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgca |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33437344 |
aacatgacattttgcaaataccccctgaagttttgcacaaatttgca |
33437390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 45160296 - 45160238
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
45160296 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
45160238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 3768456 - 3768540
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| | || ||||||||||| | |||||||||| ||||| || |||||||||| |
|
|
| T |
3768456 |
ttctgttagtcaacatgacgttttgcaaataccccat-aaaatttgcacttatgtacaaaatgccctccgaaattaaaaatttata |
3768540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 6166933 - 6166868
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
6166933 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcatttatgtgcaaaatgcc |
6166868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 41727059 - 41727002
Alignment:
| Q |
48 |
ataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
41727059 |
ataccccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttata |
41727002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 7532616 - 7532541
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccct-gaagttttgcacttatttgc-aaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| ||| |||||||||||| ||||| |||||||||| |
|
|
| T |
7532616 |
aacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaaatgcccccc-aacttaaaaatttata |
7532541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 29365948 - 29366008
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
29365948 |
caaataccccctgaaattttgcagttatgtgcaaaatgccccctaaacttaaaaatttata |
29366008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 7337900 - 7337987
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||| ||||| ||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
7337900 |
cttctgttagtcaatatgacgttttgcaaatattttcctgaagttttgcacttaagtgcaaaatgacccttgaacttgaaaatttata |
7337987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 7778480 - 7778405
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||||||| ||||||||||| || || || |||||||||| |
|
|
| T |
7778480 |
aacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccatccaaatttaaaaatttata |
7778405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 9758408 - 9758491
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||||| || | ||||||||| ||||||||| |||||||||||| |||||||||| | | |||||| ||||||| |
|
|
| T |
9758408 |
ttctgttagtcaacatcacgtattgcaaatatccccctgaatttttgcacttatgtgcaaaatgcactctgaacttaaaaattt |
9758491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 94
Target Start/End: Complemental strand, 9759098 - 9759028
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||| ||| |||| ||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
9759098 |
tgttagtcaatatgatgttttgtaaatacccc-tgaagttttgcacttatgtgcaaaatgcctcccgaactt |
9759028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 17815599 - 17815673
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
17815599 |
aacatgaagttttgcaaatacccccctgatgttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
17815673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 10575037 - 10574983
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
10575037 |
ccccctgaaattttgcacttatgtgcaaaatgcaccctaaacttgaaaatttata |
10574983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 18060464 - 18060410
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
18060464 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttata |
18060410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 27482232 - 27482178
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27482232 |
ccccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttata |
27482178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 38939230 - 38939148
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||| |||||||| ||| ||| ||||||||||||||||| | ||||||||| || || || |||||||||| |
|
|
| T |
38939230 |
tgttagtcaacatgaaattttgcagatatcccttgaagttttgcacttatgttcaaaatgccgcctaaatttaaaaatttata |
38939148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 44747084 - 44747157
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
|||||||| |||| |||||||||| || ||||||||||||||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
44747084 |
aacatgacgttttacaaatacccctctaaagttttgcacttatatgcaaaatg-tccccgaacttgaatatttat |
44747157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 45159739 - 45159793
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
45159739 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
45159793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 5438994 - 5438942
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
5438994 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
5438942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 43208993 - 43208941
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
43208993 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
43208941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 105
Target Start/End: Complemental strand, 17540320 - 17540269
Alignment:
| Q |
54 |
cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
17540320 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
17540269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 20207155 - 20207238
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||| | |||||||||||||||||| ||||||||| ||| | ||||| |||||||||| |
|
|
| T |
20207155 |
tgttagtcaacatcacgttttgcaaatattctcctgaagttttgcacttacgtgcaaaatgtccctcaaacttaaaaatttata |
20207238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 6082250 - 6082196
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
6082250 |
ccccctgaaattttgcacttaagtgcaaaatgccccctaaaattgaaaatttata |
6082196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6731378 - 6731295
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||| ||||||| |||||||| || |||||||| || |||||||||||| ||||| |
|
|
| T |
6731378 |
cttctgttagtcaacatgacgttttgcaattacctccctgaaattttgcacgta----caaaatgctccacgaacttgaaaaattata |
6731295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11871360 - 11871275
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||| |||||||||| ||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
11871360 |
ttctgttagtgaacatgaagttttacaaatacccccttgaagttttgcgcttatgtgcaaaatg-tccccaaacttaaaaatttata |
11871275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 28586966 - 28587020
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||| | |||||||||||||||| |
|
|
| T |
28586966 |
ccccctgaaattttgcacttatgtgccaaatgccctctaaacttgaaaatttata |
28587020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 43207004 - 43207058
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
43207004 |
ccccctgaaattttgcatttatgtgcaaaatgtcccctaaacttgaaaatttata |
43207058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 88
Target Start/End: Original strand, 28636577 - 28636614
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
28636577 |
ccccctgaaattttgcacttatgtgcaaaatgcccccc |
28636614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 36208096 - 36208035
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaa |
79 |
Q |
| |
|
|||| ||||| |||||| || |||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36208096 |
cttcagttagtcaacattacgttttgcaaatgcccccctgaagttttgcacttatgtgcaaa |
36208035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 28150020 - 28150056
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
28150020 |
ccccctgaaattttgcacttatgtgcaaaatgccccc |
28150056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 28150845 - 28150793
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
28150845 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
28150793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 29366500 - 29366448
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
29366500 |
ccccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
29366448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 41287268 - 41287216
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
41287268 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
41287216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 3350 - 3436
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3350 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttata |
3436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 4691 - 4625
Alignment:
| Q |
40 |
ttttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| | |||||||| |
|
|
| T |
4691 |
ttttgcaaatacccccgtgaagttttgcacttatgtgcaaaatgccccctaaacttaataatttata |
4625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 82)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23075309 - 23075223
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23075309 |
ttctgttagtcaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttata |
23075223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1326596 - 1326681
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1326596 |
ttctgttagcgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
1326681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 23767728 - 23767643
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23767728 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23767643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5417584 - 5417670
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5417584 |
ttctgttagtgaacatgacattttgcaaataccccgctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
5417670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 13045740 - 13045825
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13045740 |
ttctgttagtgaacatgacgttttgcaaatgccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13045825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 26609834 - 26609909
Alignment:
| Q |
31 |
aacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
26609834 |
aacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
26609909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 2318441 - 2318355
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
2318441 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
2318355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18739287 - 18739201
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
18739287 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
18739201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 20856838 - 20856924
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20856838 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20856924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 24111015 - 24110933
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||| || ||||| ||||||| |
|
|
| T |
24111015 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt |
24110933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 29678942 - 29678856
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
29678942 |
ttctgttagtgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
29678856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8748834 - 8748919
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8748834 |
ttctgttagtgaatatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8748919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11625352 - 11625267
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| ||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11625352 |
ttctgttagtgaacgtgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11625267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17994181 - 17994266
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
17994181 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttata |
17994266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 28537647 - 28537734
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
28537647 |
ttctgttagtcaacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttata |
28537734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 8743039 - 8742964
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8743039 |
aacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8742964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 10624581 - 10624668
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacc-ccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||||||||||||||||||| |||||||| |||| ||||||| |||||||||| |
|
|
| T |
10624581 |
cttctgttagtcaacatgatgttttgcaaataccaccctgaagttttgcacttatatgcaaaattcccctcgaacttaaaaatttata |
10624668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 13209214 - 13209289
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13209214 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13209289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 13209818 - 13209743
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13209818 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
13209743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 32155292 - 32155209
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattt |
102 |
Q |
| |
|
|||||||| |||||| || |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
32155292 |
ttctgttaatcaacatcacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaattt |
32155209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 34657940 - 34658015
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34657940 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtggaaaatgccccccgaacttgaaaatttata |
34658015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 748757 - 748843
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||| | ||||||||||||||| ||||| |||||||||| |
|
|
| T |
748757 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttata |
748843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 8812171 - 8812257
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
8812171 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttata |
8812257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8812820 - 8812734
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
8812820 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttata |
8812734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 32628635 - 32628553
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
32628635 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatt |
32628553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 2317816 - 2317900
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| ||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
2317816 |
ttctgttagtgaacatgacgttttgcaaataccccctgacgttttgcacttatgtgcaaaatg-cccccaaacttaaaaatttata |
2317900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11099955 - 11099870
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| |||||| |||||| || |||||| |||| ||||||||||||||||| |
|
|
| T |
11099955 |
ttctgttagttaacatgacgttttgcaaataccccctgatgttttgtacttatgtgtaaaatgtcccctgaacttgaaaatttata |
11099870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1059725 - 1059812
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
1059725 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
1059812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 15145901 - 15145988
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct--gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| |||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15145901 |
ttctgttagtgaacatgacgttttgcaaatactccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
15145988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 20857464 - 20857377
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
20857464 |
ttctgttagtgaacatgacgtattgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
20857377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22504349 - 22504436
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
22504349 |
ttctgttagagaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
22504436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 22821258 - 22821345
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
22821258 |
ttctgttagtgaacattacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
22821345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 23074423 - 23074506
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata--ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||| ||||| |||||| |
|
|
| T |
23074423 |
ttctgttagtcaacatgacattttgcaaataccccccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaatt |
23074506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 11099057 - 11099140
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| |||||| || ||||||||||||||| ||||||||||| |||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
11099057 |
tgttagtcaacataacgttttgcaaatacccccctgaagttttgtacttatttgcaaaatgtcccctaaacttgaaaatttata |
11099140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 32154596 - 32154671
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
||||| |||| |||||||| |||||||||| ||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
32154596 |
cttctattagtcaacatgatattttgcaaacaccccctgaagttttgcacttatgtgcaaaatgcctaccgaactt |
32154671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1155361 - 1155276
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
1155361 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgc-ccccaaacttaaaaatttata |
1155276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 5430326 - 5430399
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| |||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5430326 |
aacatgacgttttgcaaatacccc-tgaagtcttgcacttatgtgcaaaatgccccccaaactttaaaatttata |
5430399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 6138341 - 6138255
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||| |||||||||||||||||| ||||||||||| | |||||| |||||||||| |
|
|
| T |
6138341 |
cttctgttagtcaacatgacgttttacaaataccatctgaagttttgcacttatgtgcaaaatgcctcatgaacttaaaaatttata |
6138255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 15127152 - 15127226
Alignment:
| Q |
32 |
acatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
15127152 |
acatgacgttttgcaaatacccctctgaagttttgcacttatgtggaaaatgccccccaaacttaaaaatttata |
15127226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 15146529 - 15146443
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
15146529 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacataaaaatttata |
15146443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 24110430 - 24110484
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24110430 |
ccccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttata |
24110484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25404202 - 25404288
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
25404202 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttaaaaatttata |
25404288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26610408 - 26610322
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| | ||||||||||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
26610408 |
ttctgttagtgaacatgccgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
26610322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 749376 - 749289
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
749376 |
ttctgttagtgaacatgacgttttacaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
749289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1049967 - 1050054
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||| ||||| ||||||||||| |||||||||| |
|
|
| T |
1049967 |
ttctgttagtgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgccaaatgtcccccgaacttaaaaatttata |
1050054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 11158745 - 11158673
Alignment:
| Q |
34 |
atgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11158745 |
atgacgttttgcaaataccctcctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11158673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 23767081 - 23767170
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac----cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
23767081 |
ttctgttagtgaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
23767170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 25404831 - 25404763
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
25404831 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
25404763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 11957098 - 11957185
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||| |||||||| ||||||||| | ||||| |||||| |||||| |||||||||| |
|
|
| T |
11957098 |
cttctgttagtcaacatgacgttatgcaaatacccccctgaagttgtgcacttatgtacaaaaggccccctgaacttcaaaatttata |
11957185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 14394798 - 14394868
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
14394798 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccc |
14394868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 15968638 - 15968713
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||| || ||| ||||| |||||||||| |
|
|
| T |
15968638 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccgcccaaacttaaaaatttata |
15968713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 23066774 - 23066849
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
23066774 |
aacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttata |
23066849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1060350 - 1060265
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
1060350 |
ttctgttagtgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
1060265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 11624726 - 11624812
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||| ||||||||||||||| || |||||||||||||| ||||| |||||||||| |
|
|
| T |
11624726 |
ttctgttagtgagcatgacgttttgcaaataccccactgaagttttgcactcatgtgcaaaatgcccccaaaacttaaaaatttata |
11624812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 94
Target Start/End: Original strand, 29678325 - 29678390
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaactt |
94 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29678325 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt |
29678390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 1050842 - 1050766
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||| ||||||||||| ||| ||||| |||||||||| |
|
|
| T |
1050842 |
aacatgacgttttgcaaataccccccttgaagttttgcatttatgtgcaaaatgcctcccaaacttaaaaatttata |
1050766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 1327202 - 1327127
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
1327202 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
1327127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 25163609 - 25163678
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgcccccc |
88 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
25163609 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacgtatgtgcaaaatgcccccc |
25163678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 1563021 - 1563104
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||||||| ||||||||| | |||||| |||| |||||| ||||||||| |
|
|
| T |
1563021 |
ttctgttagtcaacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttat |
1563104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 22822158 - 22822075
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatt |
101 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||| |||| || |||||||||||| ||||| |||||| |
|
|
| T |
22822158 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcagttatgtgaaaaatgccccccaaacttaaaaatt |
22822075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 28538257 - 28538170
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||| |||||| ||||||||| || | ||||||||||| ||||| |
|
|
| T |
28538257 |
ttctgttagttaacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgtcctctgaacttgaaaaattata |
28538170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 8939928 - 8940003
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaact |
93 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
8939928 |
cttctgttagtgaacatgacgttttgcaaatactcccctaaagttttgcatttatgtgcaaaatgccccccaaact |
8940003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 18738442 - 18738525
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||| || ||||||| ||||| ||||| |||||||||| |
|
|
| T |
18738442 |
ttctgttagttaacatgacgttttgcaaataccccctgaagttttgcac--ataaacaaaatgtcccccaaacttaaaaatttata |
18738525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 8590642 - 8590581
Alignment:
| Q |
45 |
caaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
8590642 |
caaatacccccatgaaattttgcacttatgtgcaaaatgcccgctgaacttgaaaatttata |
8590581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 22504953 - 22504892
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaa |
80 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
22504953 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaa |
22504892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 1563966 - 1563878
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||| |||||| || ||||||||||||| |||||| || ||| ||||||||||||||||| |
|
|
| T |
1563966 |
cttctgttagtcaacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttata |
1563878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 15191944 - 15191996
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15191944 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaattta |
15191996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 51 - 103
Target Start/End: Complemental strand, 15468607 - 15468555
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15468607 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaattta |
15468555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 5400812 - 5400733
Alignment:
| Q |
31 |
aacatgacattttgcaaataccc-cctgaagttttgcacttattt----gcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |||||| | |||||||||||||| ||||| |||||||||| |
|
|
| T |
5400812 |
aacatgacgttttgcaaatacccacctgaagttttgtacttatatatgtgcaaaatgccccccaaacttaaaaatttata |
5400733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 11640972 - 11641030
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
11640972 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
11641030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 14608176 - 14608242
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgcc |
84 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||| |||||||| ||||| ||||||||||| |
|
|
| T |
14608176 |
cttctgttagtcaacatgacgttttgcaaataccccccttaagttttgtacttacgtgcaaaatgcc |
14608242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 16894569 - 16894623
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16894569 |
ccccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttata |
16894623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 16895123 - 16895065
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
16895123 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaattta |
16895065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 105
Target Start/End: Complemental strand, 34658490 - 34658444
Alignment:
| Q |
59 |
agttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
34658490 |
agttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
34658444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 15127676 - 15127623
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttat |
72 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
15127676 |
ttctgttagtgaacatgacgttttgcaaatatccccctgaagttttgcacttat |
15127623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 98
Target Start/End: Original strand, 29212911 - 29212958
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaa |
98 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
29212911 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaa |
29212958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 29724053 - 29724002
Alignment:
| Q |
52 |
cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
29724053 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
29724002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 1798670 - 1798724
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
1798670 |
ccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
1798724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 26583137 - 26583083
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| | |||||||| ||||||| |
|
|
| T |
26583137 |
ccccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaacatttata |
26583083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 23067602 - 23067553
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcac |
68 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
23067602 |
ttctgttagagaacatgacgttttgcaaatacccccgtgaagttttgcac |
23067553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 23597151 - 23597204
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttat |
72 |
Q |
| |
|
|||||||||| |||||| | ||||||||||| |||||||||||||| |||||| |
|
|
| T |
23597151 |
cttctgttagtcaacatcatgttttgcaaatatcccctgaagttttgtacttat |
23597204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 32596472 - 32596524
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||| ||||| |||||||| |
|
|
| T |
32596472 |
ccccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaattta |
32596524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0498 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: scaffold0498
Description:
Target: scaffold0498; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11320 - 11235
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
11320 |
ttctgttagtgaacatgacattttgtaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0498; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 5309 - 5393
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||| ||||||| ||||||||||||||| ||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
5309 |
ttctgttagtgaacatgacgttt-gcaaatatcccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttata |
5393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 6584 - 6499
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
6584 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
6499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13557 - 13472
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13557 |
ttctgttagccaatatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgc-ccccgaacttgaaaatttata |
13472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 12969 - 13027
Alignment:
| Q |
30 |
caacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
12969 |
caacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
13027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0444 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: scaffold0444
Description:
Target: scaffold0444; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7102 - 7188
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7102 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttata |
7188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0444; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8012 - 7926
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || ||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8012 |
ttctgttagtgaacatgacgttttgcaaatatcctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 41897 - 41812
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
41897 |
ttctgttagtgaacatgacgttttgcaaataccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttata |
41812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 35958 - 36044
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
35958 |
ttctgttagtgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttata |
36044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 41271 - 41357
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
41271 |
ttctgttagtgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttata |
41357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 94959 - 94884
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
94959 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttata |
94884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 94382 - 94456
Alignment:
| Q |
31 |
aacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||| ||| | |||||||||| |
|
|
| T |
94382 |
aacatgaagttttgcaaataccccctgatgttttgcacttatgtgcaaaatgccccccaaacataaaaatttata |
94456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 104450 - 104385
Alignment:
| Q |
40 |
ttttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
104450 |
ttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgc-ccccaaacttaaaaatttata |
104385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 56; Significance: 3e-23; HSPs: 4)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 38183 - 38100
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||||||||||||||||||||||| |||||||| |||| ||||||| |||||||| |
|
|
| T |
38183 |
ttctgttagtcaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccctcgaacttaaaaattta |
38100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 99
Target Start/End: Original strand, 37803 - 37880
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaataccccct-gaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
|||||| |||| | || ||||||| ||||||||| |||||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
37803 |
tgttagtcaacgtaacgttttgcagatacccccttgaagttttgcacttatgtgcaaaatatcctccgaacttgaaaa |
37880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 131038 - 131092
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||| ||||| |||||||||| |
|
|
| T |
131038 |
ccccctgaaattttgcacttatgtgcataatgccccctaaacttaaaaatttata |
131092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 103
Target Start/End: Complemental strand, 131584 - 131536
Alignment:
| Q |
55 |
ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
131584 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
131536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 22250 - 22336
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||||||| |||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
22250 |
cttctgttagttaacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaataccccctgaacttgaaaatttata |
22336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 55; Significance: 1e-22; HSPs: 5)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7207 - 7293
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7207 |
ttctgttagtgaacatgacgttttgcaaataccccactgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 7833 - 7747
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
7833 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
7747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 34 - 105
Target Start/End: Original strand, 46646 - 46717
Alignment:
| Q |
34 |
atgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
46646 |
atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaatttata |
46717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 67311 - 67225
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||| ||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
67311 |
ttctgttagtaaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgacccctgaacttgaaaatttata |
67225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 66722 - 66797
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |||| ||||||| ||||||| ||||| |||||||||| |
|
|
| T |
66722 |
aacatgaagttttgcaaatacccccctgaagttttgcatttatgtgcaaaaagccccccaaacttaaaaatttata |
66797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 12417 - 12503
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
12417 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13045 - 12958
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac--cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
13045 |
ttctgttagtgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
12958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0572 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0572
Description:
Target: scaffold0572; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 1696 - 1611
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
1696 |
ttctgttagtgaacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttata |
1611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1532 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold1532
Description:
Target: scaffold1532; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 22 - 105
Target Start/End: Complemental strand, 835 - 753
Alignment:
| Q |
22 |
ctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
835 |
ctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcacttatatgcaaaataacccccgaacttgaaaatttata |
753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 8165 - 8079
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
8165 |
ttctgttagtgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
8079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 7539 - 7625
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||||| |||||||||| |
|
|
| T |
7539 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatg-tccccaaacttaaaaatttata |
7625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 185724 - 185810
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
185724 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttata |
185810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 52342 - 52426
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||| |||||||||| |
|
|
| T |
52342 |
ttctgttagtgaacatgacgttttgcaaatacccc-tgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttata |
52426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0340
Description:
Target: scaffold0340; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 2360 - 2274
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||| ||||||||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
2360 |
ttctgttagtcaacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgc-ccccaaacttgaaaatttata |
2274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 1427 - 1514
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| | | |||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1427 |
ttctgttagttaacatgacgttttgcaaatacccacactaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttata |
1514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0945 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: scaffold0945
Description:
Target: scaffold0945; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 2189 - 2103
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccc-cctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| | ||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2189 |
ttctgttagtgaacatgacgttttgcaaataatctcctgaagttttgcacttatgtgcaaaatgcccatcgaacttgaaaatttata |
2103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0945; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 105
Target Start/End: Original strand, 1300 - 1375
Alignment:
| Q |
30 |
caacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||||||| |||||| ||||||||||||||| ||||||||| |||||||| || |||||||||| |
|
|
| T |
1300 |
caacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatg-cccccgaagttaaaaatttata |
1375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: scaffold0320
Description:
Target: scaffold0320; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 15660 - 15746
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccctgaa-gttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| || ||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15660 |
ttctgttagtgaacatgacgttttgcaaatacccccctaatgttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
15746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 16202 - 16156
Alignment:
| Q |
40 |
ttttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccc |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
16202 |
ttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccc |
16156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0132
Description:
Target: scaffold0132; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 42441 - 42355
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | |||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
42441 |
ttctgttagttaacatgacgttttgcaaatacccccctaaagttttgtacttatgtgcaaaatgccccgtgaacttgaaaatttata |
42355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 120753 - 120839
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||| || |||||||||||| ||||| |||||||||| |
|
|
| T |
120753 |
ttctgttagtgaacatgatgttttgcaaatacccccatgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttata |
120839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 121379 - 121311
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgcccc |
86 |
Q |
| |
|
||||||||| ||||| || |||| ||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
121379 |
ttctgttagtgaacataacgttttacaaataccccccctgaagttttgcacttatatgcaaaatgcccc |
121311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 120099 - 120046
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaata-ccccctgaagttttgcacttat |
72 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
120099 |
ttctgttaatcaacatgacattttgcaaatatcctactgaagttttgcacttat |
120046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 43375 - 43288
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||| ||||||| ||||||||||||||| || || |||||||||| |
|
|
| T |
43375 |
ttctgttagtgaacatgacgttttgcaaatacccctcctgaagttttacacttatgtgcaaaatgccccccaaagttaaaaatttata |
43288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0249 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0249
Description:
Target: scaffold0249; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 24385 - 24472
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| ||||| || |||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
24385 |
cttctgttagtcaacatgacgttttgtaaatacacccctaaatttttgcacttatctgcacaatgcccttcgaacttgaaaatttata |
24472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 4498 - 4581
Alignment:
| Q |
23 |
tgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||| ||| ||||| |||||||||||| |||||||||||| ||| |||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
4498 |
tgttagtcaatatgacgttttgcaaatactcccctgaagtttagcagttatgtgcaaaatgtcccccgaactttaaaatttata |
4581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 5207 - 5127
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||| | ||||||||||||||||| ||||||||||| | ||||||| |||| |
|
|
| T |
5207 |
cttctgttaatcaacatgacgttttacaaatacttcttgaagttttgcacttatgtgcaaaatgcctcgcgaacttaaaaa |
5127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 239299 - 239374
Alignment:
| Q |
31 |
aacatgacattttgcaaata-ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| || ||||||| |
|
|
| T |
239299 |
aacataacgttttgcaaatatccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaatatttata |
239374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 77077 - 77146
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
77077 |
ttctgttagtgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccc |
77146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0343
Description:
Target: scaffold0343; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 10264 - 10321
Alignment:
| Q |
31 |
aacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
10264 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccc |
10321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 10877 - 10809
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatac-cccctgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| || ||||| ||||| |
|
|
| T |
10877 |
ttctgttagtgaacatgacgttttgcaaatactcccctgaagttttgcacttatatgtaaaataccccc |
10809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 35036 - 34948
Alignment:
| Q |
19 |
cttctgttagccaacatgacattttgcaaataccccc--tgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||| | |||||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
35036 |
cttctattagtcaacatgatgttttgcaaataccctccttgaagttttgcacttacgtgcaaaatgcctcctgaacttgaaaatttata |
34948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 10707 - 10739
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
10707 |
ccccctgaagttttgcacttatgtgcaaaatgc |
10739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1063 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold1063
Description:
Target: scaffold1063; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 382 - 442
Alignment:
| Q |
24 |
gttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatgc |
83 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
382 |
gttagctaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgc |
442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1063; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 970 - 912
Alignment:
| Q |
30 |
caacatgacattttgcaaataccccc-tgaagttttgcacttatttgcaaaatgccccc |
87 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
970 |
caacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccc |
912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 17397 - 17484
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc--ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| |||| |||||||| |||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
17397 |
ttctgttagtgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttata |
17484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 1837 - 1900
Alignment:
| Q |
20 |
ttctgttagccaacatgacattttgcaaatacccc-ctgaagttttgcacttatttgcaaaatg |
82 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
1837 |
ttctgttagtgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg |
1900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0672 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0672
Description:
Target: scaffold0672; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 5428 - 5486
Alignment:
| Q |
45 |
caaataccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
5428 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
5486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 104
Target Start/End: Original strand, 12286 - 12339
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttat |
104 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
12286 |
ccccctgaaattttgcacttatgtgcaaaatgccccctaaacctgaaaatttat |
12339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 103
Target Start/End: Complemental strand, 13108 - 13055
Alignment:
| Q |
50 |
accccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaattta |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
13108 |
accccctgaaattttgcacttatttgcaaaataccccctaaacttaaaaattta |
13055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 16556 - 16502
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
||||||||| ||| ||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
16556 |
ccccctgaaatttgacacttatatgcaaaatgccccctaaacttgaaaatttata |
16502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 28660 - 28599
Alignment:
| Q |
45 |
caaatacccc-ctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaatttata |
105 |
Q |
| |
|
|||||||||| ||||| |||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
28660 |
caaataccccactgaaattttacacttatgtgcaaaatgccccttaaacttgaaaatttata |
28599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 42455 - 42407
Alignment:
| Q |
51 |
ccccctgaagttttgcacttatttgcaaaatgccccccgaacttgaaaa |
99 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| || |||||||||| |
|
|
| T |
42455 |
ccccctgaaattttgcacttatgtgcaaaatgccacctaaacttgaaaa |
42407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University