View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_low_18 (Length: 240)
Name: NF4414_low_18
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_low_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 3611489 - 3611708
Alignment:
| Q |
19 |
aactatttgtcataagaatcatatatcccatgattccatgtcccactttcttgtctttggaatatcaacggttctgtttttgttcacaaccttaataaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611489 |
aactatttgtcataagaatcatatatcccatgattccatgtcccactttcttgtctttggaatatcaacggttctgtttttgttcacaaccttaataaaa |
3611588 |
T |
|
| Q |
119 |
ttatagctttatgagctccatttattaccacatgtgtaccttattatataatctcttttcatcatttttagatatattnnnnnnntagataatgttgtac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3611589 |
ttatagctttatgagctccatttattaccacatgtgtaccttat--tttaatctcttttcatcatttttacatatattaaaaaaatagataatgttgtac |
3611686 |
T |
|
| Q |
219 |
ctaaaaatgtattagataatgt |
240 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
3611687 |
ctaaaaatatattagataatgt |
3611708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University