View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4414_low_21 (Length: 228)
Name: NF4414_low_21
Description: NF4414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4414_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 16607968 - 16607767
Alignment:
| Q |
13 |
gataattctggacctggtgctataactcataatagggtacaatggcatggttacaatttaatgactcctaatcaagcttggaatttcactgtgcttaatt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16607968 |
gataattatggacctggtgctataactcataatagggtacaatggcatggttacaatttaatgactcctaatcaagcttggaatttcactgtgcttaatt |
16607869 |
T |
 |
| Q |
113 |
ttacattggggaatacttggcttcctgatacagatgtaccttacactgaaggactacatttagatgattgaagtaataaatttgattcattatatttgct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16607868 |
ttacattggggaatacttggcttcctgatacagatgtaccttacactgaaggactacatttagatgattgaagtaataaatttgattcattatatttgct |
16607769 |
T |
 |
| Q |
213 |
ag |
214 |
Q |
| |
|
|| |
|
|
| T |
16607768 |
ag |
16607767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 84 - 165
Target Start/End: Original strand, 2576487 - 2576568
Alignment:
| Q |
84 |
tcaagcttggaatttcactgtgcttaattttacattggggaatacttggcttcctgatacagatgtaccttacactgaagga |
165 |
Q |
| |
|
||||||||||||||| || || ||||| ||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2576487 |
tcaagcttggaattttacagtacttaactttactttgggaaatacttggcttcctgatacagatataccttacactgaagga |
2576568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University