View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4415-Insertion-11 (Length: 215)
Name: NF4415-Insertion-11
Description: NF4415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4415-Insertion-11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 52103980 - 52104199
Alignment:
| Q |
7 |
attgaccgcccatgatgtcattcaaatcaacaatgaaacttgacaaataattgacacaaattgcaca-----------------aattttggtatcctcc |
89 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52103980 |
attgaccggccatgatgtcattgaaatcaacaatgaaacttgacaaataattgacacaaattgcacaaattcatttagttcacaaattttggtatcctcc |
52104079 |
T |
|
| Q |
90 |
ttacccaactacatagtaatagtatattcccttccttccaagttgtttctcacaaatactaagtgcacaatatttactaatggattttggaggagttttc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52104080 |
ttacccaactacatagtaatagtatattcccttccttccaagttgtttctcacaaatactaagtgcacaatatttactaatggattttggaggatttttc |
52104179 |
T |
|
| Q |
190 |
tttgcaaaattcgttcggtg |
209 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52104180 |
tttgcaaaattcgttcggtg |
52104199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University