View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4415-Insertion-14 (Length: 158)

Name: NF4415-Insertion-14
Description: NF4415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4415-Insertion-14
NF4415-Insertion-14
[»] chr4 (1 HSPs)
chr4 (5-158)||(23522381-23522534)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 23522534 - 23522381
Alignment:
5 acataaacatcaacataatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg 104  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23522534 acataaacatcaacgtaatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg 23522435  T
105 atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttc 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23522434 atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttc 23522381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University