View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4415-Insertion-14 (Length: 158)
Name: NF4415-Insertion-14
Description: NF4415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4415-Insertion-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 23522534 - 23522381
Alignment:
| Q |
5 |
acataaacatcaacataatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522534 |
acataaacatcaacgtaatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg |
23522435 |
T |
|
| Q |
105 |
atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522434 |
atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttc |
23522381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University