View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4415_low_9 (Length: 245)
Name: NF4415_low_9
Description: NF4415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4415_low_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 15591352 - 15591584
Alignment:
| Q |
13 |
ccagttgtatagaagagggcgttgatctctcaaactaaatgatacatcagtttctacaaggagagctgatgatgattctatgcaaaatcttagccagatc |
112 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
15591352 |
ccagttgtagagaagagggcgttgatctctcaaactaaatgatacatcagtttctacaaggag--ctgatgatgattctacgcaaaatctgagccagatc |
15591449 |
T |
|
| Q |
113 |
agcaactcctttgagaaaactttgggccttatccatcagctttaccaccttaccgtctccaccttgaacgttgtcttttaaatgtcactgca--tttttt |
210 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
15591450 |
agcaactcctttgagaaaacgttcggccttatccatcagctttaccaccttaccgtctccaccttgaacgttgtctttcaaatgtcactgcatttttttt |
15591549 |
T |
|
| Q |
211 |
ataggtctttgtcttaacggtgatgatcaaaatac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15591550 |
ataggtctttgtcttaacggtgatgatcagaatac |
15591584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 82 - 153
Target Start/End: Complemental strand, 35445739 - 35445668
Alignment:
| Q |
82 |
tgatgattctatgcaaaatcttagccagatcagcaactcctttgagaaaactttgggccttatccatcagct |
153 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
35445739 |
tgatgattctatgcaaaaccttagccagatcagcaactccattgagaaaaccctgggcctcatccatcagct |
35445668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University