View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417-Insertion-12 (Length: 156)
Name: NF4417-Insertion-12
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417-Insertion-12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 8 - 156
Target Start/End: Complemental strand, 50222069 - 50221921
Alignment:
| Q |
8 |
agaacatcgagtttacattttgttgaaactttaactttcagttgtattcaacaaatgaaagagttgcaaccatgcagttgagtttttcattaaaaagacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50222069 |
agaacatcgagtttacattttgttgaaactttaactttcagttgtattcagcaaatgaaagagttgcaaccatgcagttgagtttttcattaaaaagacc |
50221970 |
T |
|
| Q |
108 |
ttaagcatttattcatttcaggttgttttagtaagaaaaaaggcactga |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50221969 |
ttaagcatttattcatttcaggttgttttagtaagaaaaaaggcactga |
50221921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University