View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417-Insertion-6 (Length: 307)
Name: NF4417-Insertion-6
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417-Insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 28239426 - 28239693
Alignment:
| Q |
8 |
ctgtgatgataaaaggtggtgtcaaacctaatgttgcttgttatcgctcagtttatgatggactatacaaaggccaaggtggatcaaaaagcaaccttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239426 |
ctgtgatgataaaaggtggtgtcaaacctaatgttgcttgttatcgctcagtttatgatggactatacaaaggccaaggtggatcaaaaagcaaccttat |
28239525 |
T |
 |
| Q |
108 |
gaataagattgnnnnnnnggtcaaaagactgctactttccgtaccttacgagtttaacggtatttcttatgattgaactacaacaaactatttatagtgg |
207 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239526 |
gaataagattgaaaaaaaggtcaaaaaactgctactttccgtaccttacgagtttaacggtatttcttatgattgaactacaacaaactatttatagtgg |
28239625 |
T |
 |
| Q |
208 |
gattgtttggtaaaacatcgaaagacaagttggttgtgttccagttgatgatgatggtgaaacaataa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239626 |
gattgtttggtaaaacatcgaaagacaagttggttgtgttccagttgatgatgatggtgaaacaataa |
28239693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 94
Target Start/End: Original strand, 28231736 - 28231819
Alignment:
| Q |
11 |
tgatgataaaaggtggtgtcaaacctaatgttgcttgttatcgctcagtttatgatggactatacaaaggccaaggtggatcaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||| | ||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
28231736 |
tgatgataaaaggtggtgtcaaacctaacgttgctagttaccactcagttattgatggactatacaaaagccaaggtggatcaa |
28231819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 174 - 260
Target Start/End: Original strand, 28231896 - 28231983
Alignment:
| Q |
174 |
ttatgattgaactacaa-caaactatttatagtgggattgtttggtaaaacatcgaaagacaagttggttgtgttccagttgatgatg |
260 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||| |||||||| ||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
28231896 |
ttatgattgaacaacaaacaaactatttaaagtgggcgtgtttggtgaaacatccaaagacaagttggttgcattctagttgatgatg |
28231983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 6326583 - 6326514
Alignment:
| Q |
8 |
ctgtgatgataaaaggtggtgtcaaacctaatgttgcttgttatcgctcagtttatgatggactatacaa |
77 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |||||| ||||||| ||||||| ||||||| |
|
|
| T |
6326583 |
ctgtgatgataaaaggcggtctcaaacctaatgttgctagttatcactcagttgctgatggaatatacaa |
6326514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 24621616 - 24621575
Alignment:
| Q |
11 |
tgatgataaaaggtggtgtcaaacctaatgttgcttgttatc |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24621616 |
tgatgataaaagctggtgtcaaacctaatgttgcttgttatc |
24621575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 23787262 - 23787300
Alignment:
| Q |
14 |
tgataaaaggtggtgtcaaacctaatgttgcttgttatc |
52 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23787262 |
tgataaaagctggtgtcaaacctaatgttgcttgttatc |
23787300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 14508657 - 14508590
Alignment:
| Q |
13 |
atgataaaaggtggtgtcaaacctaatgttgcttgttatcgctcagtttatgatggactatacaaagg |
80 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| || ||| || ||||| |||||||||||| |
|
|
| T |
14508657 |
atgataaaaggtggtgtcaaacctattgttgctagttttcactcggtgattgatgaactatacaaagg |
14508590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 47569524 - 47569567
Alignment:
| Q |
175 |
tatgattgaactacaacaaactatttatagtgggattgtttggt |
218 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
47569524 |
tatgattgaacaacaacaaactatttaaagtgggcttgtttggt |
47569567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 47569363 - 47569404
Alignment:
| Q |
11 |
tgatgataaaaggtggtgtcaaacctaatgttgcttgttatc |
52 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
47569363 |
tgatgataaaaggtagtgtcaaacctaatgctgctagttatc |
47569404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 28326558 - 28326602
Alignment:
| Q |
8 |
ctgtgatgataaaaggtggtgtcaaacctaatgttgcttgttatc |
52 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
28326558 |
ctgtcatgataaaaggtggtctcagacctaatgttgctagttatc |
28326602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 1718125 - 1718164
Alignment:
| Q |
13 |
atgataaaaggtggtgtcaaacctaatgttgcttgttatc |
52 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1718125 |
atgataaaaggtggtgtcaaacctattgttgctggttatc |
1718164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 28804264 - 28804227
Alignment:
| Q |
7 |
actgtgatgataaaaggtggtgtcaaacctaatgttgc |
44 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
28804264 |
actgttatgataaaaagtggtgtcaaacctaatgttgc |
28804227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 9 - 40
Target Start/End: Original strand, 16375422 - 16375453
Alignment:
| Q |
9 |
tgtgatgataaaaggtggtgtcaaacctaatg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16375422 |
tgtgatgataaaaggtggtgtcaaacctaatg |
16375453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University