View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417-Insertion-7 (Length: 274)
Name: NF4417-Insertion-7
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 30938903 - 30938691
Alignment:
| Q |
8 |
tgattaatgatttatattttactgaatcgacacatatcatgattcatccagctcacttctcatcaaaacctaacctcagcacaacggctctaaggtgccc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30938903 |
tgattaatgatttatattttactgaatccacacatatcatgattcatccagctcacttctcatcaaaacccaacctcagcacaacggctctaaggtgccc |
30938804 |
T |
|
| Q |
108 |
ccaattgattcgatcatagatcctactagtgtcggttttaagtgccttgacccccctccattctactaaacttactcttcaaattataatgaatagtttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30938803 |
ccaattgattcgatcatagatcctactagtgtctgttttaagtgccttgacccccctccattctactaaacttactcttcaaattataatgaatagtttc |
30938704 |
T |
|
| Q |
208 |
aattgatgacatg |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30938703 |
aattgatgacatg |
30938691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 246
Target Start/End: Original strand, 31574623 - 31574660
Alignment:
| Q |
209 |
attgatgacatgccgtcattacgtaatatttatgactt |
246 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
31574623 |
attgatgacatgctgtcattacgtaatatttaggactt |
31574660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University